Incidental Mutation 'R5111:Palb2'
ID393858
Institutional Source Beutler Lab
Gene Symbol Palb2
Ensembl Gene ENSMUSG00000044702
Gene Namepartner and localizer of BRCA2
Synonyms
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5111 (G1)
Quality Score101
Status Validated
Chromosome7
Chromosomal Location122107262-122132985 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 122117305 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 488 (C488*)
Ref Sequence ENSEMBL: ENSMUSP00000102077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063587] [ENSMUST00000098068] [ENSMUST00000106468] [ENSMUST00000106469] [ENSMUST00000131657] [ENSMUST00000142952]
Predicted Effect probably null
Transcript: ENSMUST00000063587
AA Change: C131*
SMART Domains Protein: ENSMUSP00000063514
Gene: ENSMUSG00000044702
AA Change: C131*

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
PDB:3EU7|A 36 383 N/A PDB
SCOP:d2bbkh_ 231 381 4e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098068
AA Change: C851*
SMART Domains Protein: ENSMUSP00000095675
Gene: ENSMUSG00000044702
AA Change: C851*

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:PALB2_WD40 755 1102 2.4e-183 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106468
AA Change: C851*
SMART Domains Protein: ENSMUSP00000102076
Gene: ENSMUSG00000044702
AA Change: C851*

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
PDB:3EU7|A 753 984 1e-131 PDB
Predicted Effect probably null
Transcript: ENSMUST00000106469
AA Change: C488*
SMART Domains Protein: ENSMUSP00000102077
Gene: ENSMUSG00000044702
AA Change: C488*

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
PDB:3EU7|A 390 740 N/A PDB
SCOP:d2bbkh_ 588 738 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131657
Predicted Effect probably benign
Transcript: ENSMUST00000142952
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality with impaired inner cell mass proliferation, impaired gastrulation, absence of the amnion, somites and tail bud, and general improper organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Palb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Palb2 APN 7 122121048 splice site probably benign
IGL00232:Palb2 APN 7 122121064 missense probably damaging 0.99
IGL02171:Palb2 APN 7 122107586 missense probably damaging 1.00
IGL03030:Palb2 APN 7 122113256 missense probably damaging 1.00
IGL03102:Palb2 APN 7 122124499 missense possibly damaging 0.88
R0128:Palb2 UTSW 7 122128166 nonsense probably null
R1192:Palb2 UTSW 7 122128209 missense probably benign 0.11
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1575:Palb2 UTSW 7 122110838 splice site probably null
R1664:Palb2 UTSW 7 122124392 utr 3 prime probably benign
R1852:Palb2 UTSW 7 122114314 missense possibly damaging 0.93
R1984:Palb2 UTSW 7 122127080 missense probably damaging 0.96
R2061:Palb2 UTSW 7 122124525 missense possibly damaging 0.86
R2121:Palb2 UTSW 7 122127781 missense possibly damaging 0.61
R2877:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R2878:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R3923:Palb2 UTSW 7 122117360 splice site probably null
R4609:Palb2 UTSW 7 122124723 missense probably benign 0.16
R4629:Palb2 UTSW 7 122127966 missense possibly damaging 0.89
R4678:Palb2 UTSW 7 122127366 missense probably damaging 0.99
R5381:Palb2 UTSW 7 122128413 missense probably benign 0.06
R5470:Palb2 UTSW 7 122114351 missense probably damaging 1.00
R5793:Palb2 UTSW 7 122127637 missense probably benign 0.05
R6160:Palb2 UTSW 7 122128420 splice site probably null
R6630:Palb2 UTSW 7 122124529 missense probably damaging 0.97
R6783:Palb2 UTSW 7 122127488 missense probably damaging 1.00
R6897:Palb2 UTSW 7 122127047 critical splice donor site probably null
R7040:Palb2 UTSW 7 122114399 missense possibly damaging 0.88
R7121:Palb2 UTSW 7 122124834 missense probably benign 0.18
R7438:Palb2 UTSW 7 122117331 missense probably damaging 0.96
R7522:Palb2 UTSW 7 122113278 missense probably damaging 1.00
R7583:Palb2 UTSW 7 122127342 missense probably benign 0.15
R7679:Palb2 UTSW 7 122128014 missense probably benign 0.00
R7769:Palb2 UTSW 7 122128415 missense probably benign 0.11
R7802:Palb2 UTSW 7 122110896 splice site probably null
R8271:Palb2 UTSW 7 122124874 missense probably damaging 0.99
R8428:Palb2 UTSW 7 122112001 missense possibly damaging 0.54
X0060:Palb2 UTSW 7 122114478 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCCTGCTTTTAATACTGAAGTGTG -3'
(R):5'- TCACACTTCGCACATAGTCC -3'

Sequencing Primer
(F):5'- ACTGAAGTGTGAGTTATAATGTGTAC -3'
(R):5'- GTAATCTCAGCTCCTCAGAAGGCTG -3'
Posted On2016-06-15