Incidental Mutation 'R5111:Arhgef10'
ID393859
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene NameRho guanine nucleotide exchange factor (GEF) 10
Synonyms6430549H08Rik
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5111 (G1)
Quality Score219
Status Validated
Chromosome8
Chromosomal Location14911663-15001085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14932408 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 179 (D179G)
Ref Sequence ENSEMBL: ENSMUSP00000106424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000161162]
Predicted Effect probably benign
Transcript: ENSMUST00000084207
AA Change: D179G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: D179G

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110800
AA Change: D179G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: D179G

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160619
Predicted Effect probably benign
Transcript: ENSMUST00000161162
AA Change: D179G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125606
Gene: ENSMUSG00000071176
AA Change: D179G

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
coiled coil region 307 334 N/A INTRINSIC
RhoGEF 400 579 2.2e-51 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 14975006 missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14940378 unclassified probably benign
IGL01012:Arhgef10 APN 8 14979977 missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 14991054 splice site probably null
IGL01596:Arhgef10 APN 8 14999468 nonsense probably null
IGL01888:Arhgef10 APN 8 14962577 nonsense probably null
IGL01938:Arhgef10 APN 8 14991062 missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14928889 missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14947205 missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 14997551 missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 14954819 missense probably benign 0.01
IGL02500:Arhgef10 APN 8 14961238 missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL03113:Arhgef10 APN 8 14954505 missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14928847 missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R0197:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 14991070 missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14940343 missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14940225 missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 14991211 missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14947157 missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 14979836 missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 14956987 splice site probably benign
R2051:Arhgef10 UTSW 8 14945320 missense probably null 1.00
R2088:Arhgef10 UTSW 8 14983898 missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2318:Arhgef10 UTSW 8 14928855 missense probably damaging 1.00
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2874:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2874:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R3522:Arhgef10 UTSW 8 14954918 missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 14979998 missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14940335 missense possibly damaging 0.77
R4351:Arhgef10 UTSW 8 14991145 nonsense probably null
R4384:Arhgef10 UTSW 8 14930157 nonsense probably null
R4385:Arhgef10 UTSW 8 14930157 nonsense probably null
R4685:Arhgef10 UTSW 8 14956963 missense probably damaging 1.00
R5169:Arhgef10 UTSW 8 14930051 missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 14954774 missense probably benign 0.01
R5945:Arhgef10 UTSW 8 14980028 critical splice donor site probably null
R6593:Arhgef10 UTSW 8 14962522 missense probably damaging 1.00
R6593:Arhgef10 UTSW 8 14962564 missense possibly damaging 0.82
R6734:Arhgef10 UTSW 8 14975053 missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 14975005 missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14928786 missense probably benign 0.27
R7068:Arhgef10 UTSW 8 14958639 missense probably damaging 1.00
R7081:Arhgef10 UTSW 8 14997547 nonsense probably null
R7157:Arhgef10 UTSW 8 14930030 missense probably damaging 1.00
R7232:Arhgef10 UTSW 8 14940323 missense probably benign 0.10
R7514:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R7544:Arhgef10 UTSW 8 14979854 missense probably benign 0.34
R7657:Arhgef10 UTSW 8 14979893 missense probably damaging 1.00
R7736:Arhgef10 UTSW 8 14980583 nonsense probably null
R7777:Arhgef10 UTSW 8 14945373 missense probably damaging 1.00
R8000:Arhgef10 UTSW 8 14930054 missense probably damaging 1.00
R8060:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R8441:Arhgef10 UTSW 8 14991237 splice site probably benign
R8545:Arhgef10 UTSW 8 14928868 missense probably benign 0.00
R8545:Arhgef10 UTSW 8 14975931 missense possibly damaging 0.83
R8702:Arhgef10 UTSW 8 14942638 missense probably benign
R8846:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R8854:Arhgef10 UTSW 8 14979798 critical splice acceptor site probably null
X0024:Arhgef10 UTSW 8 14978486 missense probably benign 0.01
X0027:Arhgef10 UTSW 8 14997631 missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 14964191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTGTGCCAGATGACAGCAC -3'
(R):5'- CTGTTCACCAACTCACAGTTTACAC -3'

Sequencing Primer
(F):5'- AGATGACAGCACCGTCTCCTG -3'
(R):5'- CACTGATGCTTCTGTGGTGG -3'
Posted On2016-06-15