Incidental Mutation 'R0446:Tmem25'
ID39386
Institutional Source Beutler Lab
Gene Symbol Tmem25
Ensembl Gene ENSMUSG00000002032
Gene Nametransmembrane protein 25
Synonyms0610039J01Rik
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44793769-44799307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44796581 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 139 (Y139C)
Ref Sequence ENSEMBL: ENSMUSP00000110353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002099] [ENSMUST00000002100] [ENSMUST00000044694] [ENSMUST00000114705] [ENSMUST00000132020] [ENSMUST00000213203] [ENSMUST00000213363] [ENSMUST00000213972] [ENSMUST00000214431] [ENSMUST00000214833]
Predicted Effect probably benign
Transcript: ENSMUST00000002099
SMART Domains Protein: ENSMUSP00000002099
Gene: ENSMUSG00000002031

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
Pfam:IFT46_B_C 60 270 6.2e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000002100
AA Change: Y139C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002100
Gene: ENSMUSG00000002032
AA Change: Y139C

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
Pfam:C2-set_2 26 118 2.7e-14 PFAM
SCOP:d1ie5a_ 121 220 2e-6 SMART
transmembrane domain 238 260 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044694
SMART Domains Protein: ENSMUSP00000042183
Gene: ENSMUSG00000039438

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:TPR_11 46 112 2.1e-13 PFAM
Pfam:TPR_9 54 123 5.8e-7 PFAM
Pfam:TPR_1 82 113 2.3e-6 PFAM
Pfam:TPR_2 82 114 1.2e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114705
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110353
Gene: ENSMUSG00000002032
AA Change: Y139C

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
Pfam:C2-set_2 26 118 2.2e-15 PFAM
SCOP:d1ie5a_ 121 220 2e-6 SMART
transmembrane domain 238 260 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132020
Predicted Effect probably damaging
Transcript: ENSMUST00000213203
AA Change: Y139C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000213363
Predicted Effect probably benign
Transcript: ENSMUST00000213972
Predicted Effect probably benign
Transcript: ENSMUST00000214431
Predicted Effect probably damaging
Transcript: ENSMUST00000214833
AA Change: Y139C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216449
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Tmem25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Tmem25 APN 9 44795519 unclassified probably benign
IGL01980:Tmem25 APN 9 44798271 nonsense probably null
IGL02000:Tmem25 APN 9 44798271 nonsense probably null
IGL03407:Tmem25 APN 9 44796339 missense probably damaging 1.00
R0690:Tmem25 UTSW 9 44795514 unclassified probably benign
R0960:Tmem25 UTSW 9 44795512 critical splice acceptor site probably null
R1204:Tmem25 UTSW 9 44795232 missense probably benign 0.17
R1899:Tmem25 UTSW 9 44798216 unclassified probably null
R1927:Tmem25 UTSW 9 44796483 missense possibly damaging 0.77
R2088:Tmem25 UTSW 9 44796086 missense possibly damaging 0.94
R3027:Tmem25 UTSW 9 44798214 unclassified probably null
R6854:Tmem25 UTSW 9 44796008 missense possibly damaging 0.46
R7305:Tmem25 UTSW 9 44795408 critical splice donor site probably null
R7655:Tmem25 UTSW 9 44798343 missense possibly damaging 0.82
R7656:Tmem25 UTSW 9 44798343 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAGTTGCTCACCTGGAGCTGGAAG -3'
(R):5'- TGAATTGATGCTGTACCAGCAGACC -3'

Sequencing Primer
(F):5'- TAGTGACACCCACGTCATTGG -3'
(R):5'- AGCAGACCCTGCTACCTG -3'
Posted On2013-05-23