Incidental Mutation 'R0446:Tmem25'
ID 39386
Institutional Source Beutler Lab
Gene Symbol Tmem25
Ensembl Gene ENSMUSG00000002032
Gene Name transmembrane protein 25
Synonyms 0610039J01Rik
MMRRC Submission 038647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0446 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44705066-44710604 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44707878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 139 (Y139C)
Ref Sequence ENSEMBL: ENSMUSP00000110353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002099] [ENSMUST00000002100] [ENSMUST00000044694] [ENSMUST00000114705] [ENSMUST00000132020] [ENSMUST00000213203] [ENSMUST00000213363] [ENSMUST00000213972] [ENSMUST00000214431] [ENSMUST00000214833]
AlphaFold Q9DCF1
Predicted Effect probably benign
Transcript: ENSMUST00000002099
SMART Domains Protein: ENSMUSP00000002099
Gene: ENSMUSG00000002031

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
Pfam:IFT46_B_C 60 270 6.2e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000002100
AA Change: Y139C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002100
Gene: ENSMUSG00000002032
AA Change: Y139C

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
Pfam:C2-set_2 26 118 2.7e-14 PFAM
SCOP:d1ie5a_ 121 220 2e-6 SMART
transmembrane domain 238 260 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044694
SMART Domains Protein: ENSMUSP00000042183
Gene: ENSMUSG00000039438

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:TPR_11 46 112 2.1e-13 PFAM
Pfam:TPR_9 54 123 5.8e-7 PFAM
Pfam:TPR_1 82 113 2.3e-6 PFAM
Pfam:TPR_2 82 114 1.2e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114705
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110353
Gene: ENSMUSG00000002032
AA Change: Y139C

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
Pfam:C2-set_2 26 118 2.2e-15 PFAM
SCOP:d1ie5a_ 121 220 2e-6 SMART
transmembrane domain 238 260 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132020
Predicted Effect probably damaging
Transcript: ENSMUST00000213203
AA Change: Y139C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000213363
Predicted Effect probably benign
Transcript: ENSMUST00000213972
Predicted Effect probably benign
Transcript: ENSMUST00000214431
Predicted Effect probably damaging
Transcript: ENSMUST00000214833
AA Change: Y139C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214931
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,971,766 (GRCm39) T42A probably benign Het
Actr3b T A 5: 26,036,730 (GRCm39) I181K probably damaging Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
B3galt4 T C 17: 34,169,992 (GRCm39) E82G probably benign Het
Bag1 G A 4: 40,936,609 (GRCm39) T349I probably benign Het
Brip1 A T 11: 86,048,427 (GRCm39) L305Q probably damaging Het
Cdipt A G 7: 126,577,436 (GRCm39) T61A probably damaging Het
Cmya5 T A 13: 93,230,164 (GRCm39) R1641S probably benign Het
Cog7 T C 7: 121,536,295 (GRCm39) D515G probably benign Het
Cpsf4 T A 5: 145,114,054 (GRCm39) L171Q probably damaging Het
Cstpp1 G A 2: 91,135,109 (GRCm39) T20I possibly damaging Het
Cuzd1 A T 7: 130,918,009 (GRCm39) probably null Het
Dapk1 T A 13: 60,873,101 (GRCm39) probably null Het
Diaph1 A G 18: 37,986,643 (GRCm39) V1114A possibly damaging Het
Emx2 A T 19: 59,452,348 (GRCm39) K211* probably null Het
Fam170a T A 18: 50,413,699 (GRCm39) C55S possibly damaging Het
Fbxw26 A G 9: 109,572,788 (GRCm39) S119P probably benign Het
Fhip2a G A 19: 57,369,839 (GRCm39) D461N probably benign Het
Fryl G A 5: 73,254,760 (GRCm39) T894M possibly damaging Het
Gad1-ps C A 10: 99,281,383 (GRCm39) noncoding transcript Het
Gss T C 2: 155,409,665 (GRCm39) E257G probably benign Het
Klhdc1 A C 12: 69,330,082 (GRCm39) S404R probably benign Het
Kmt2e T A 5: 23,702,532 (GRCm39) probably null Het
Krt20 G A 11: 99,328,602 (GRCm39) Q108* probably null Het
Lmnb1 T A 18: 56,876,331 (GRCm39) S480T probably benign Het
Lyst T A 13: 13,812,633 (GRCm39) M1015K probably benign Het
Mdm1 T G 10: 117,987,961 (GRCm39) S290A probably benign Het
Mkln1 T A 6: 31,426,439 (GRCm39) F238I probably damaging Het
Mrgprb3 A G 7: 48,292,984 (GRCm39) V189A probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neurod6 C T 6: 55,656,614 (GRCm39) E8K probably benign Het
Nlrp12 T C 7: 3,282,659 (GRCm39) I747V probably benign Het
Notch4 C T 17: 34,784,337 (GRCm39) R43W possibly damaging Het
Obscn A T 11: 58,886,238 (GRCm39) probably benign Het
Or10d3 A T 9: 39,461,747 (GRCm39) I140N probably damaging Het
Or5p57 A T 7: 107,665,932 (GRCm39) Y24* probably null Het
Or5w20 T C 2: 87,727,199 (GRCm39) Y219H possibly damaging Het
Or6ae1 A T 7: 139,742,384 (GRCm39) S160T probably damaging Het
Or6z5 T C 7: 6,478,024 (GRCm39) V305A probably benign Het
Or8b53 G T 9: 38,667,114 (GRCm39) L43F probably damaging Het
Orc5 C T 5: 22,751,455 (GRCm39) V85I probably benign Het
Pccb T C 9: 100,864,850 (GRCm39) D468G probably damaging Het
Pdzd2 A T 15: 12,375,110 (GRCm39) V1675E probably benign Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Pltp A T 2: 164,696,320 (GRCm39) N97K probably damaging Het
Polr1a T C 6: 71,927,648 (GRCm39) probably null Het
Prss42 G A 9: 110,628,341 (GRCm39) V162I possibly damaging Het
Rbfox2 A T 15: 76,983,455 (GRCm39) Y269N probably damaging Het
Rftn2 A T 1: 55,253,354 (GRCm39) I83K probably damaging Het
S1pr4 A T 10: 81,334,823 (GRCm39) I217N probably damaging Het
Slc23a2 T C 2: 131,920,353 (GRCm39) K184R probably benign Het
Slc6a19 T C 13: 73,839,814 (GRCm39) N156S probably benign Het
Svep1 C T 4: 58,088,280 (GRCm39) G1723D probably damaging Het
Tbc1d32 T A 10: 56,068,994 (GRCm39) H358L possibly damaging Het
Tex55 G A 16: 38,649,064 (GRCm39) T15I probably benign Het
Tigit G T 16: 43,482,634 (GRCm39) N33K probably damaging Het
Trmt13 G A 3: 116,376,275 (GRCm39) T372M probably damaging Het
Ubr2 A T 17: 47,294,224 (GRCm39) M303K probably damaging Het
Usp34 A G 11: 23,417,207 (GRCm39) E2952G probably damaging Het
Zan T A 5: 137,389,920 (GRCm39) I4851F unknown Het
Zfand4 C T 6: 116,265,015 (GRCm39) T160I probably benign Het
Zfp1005 A G 2: 150,109,993 (GRCm39) T228A possibly damaging Het
Other mutations in Tmem25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Tmem25 APN 9 44,706,816 (GRCm39) unclassified probably benign
IGL01980:Tmem25 APN 9 44,709,568 (GRCm39) nonsense probably null
IGL02000:Tmem25 APN 9 44,709,568 (GRCm39) nonsense probably null
IGL03407:Tmem25 APN 9 44,707,636 (GRCm39) missense probably damaging 1.00
R0690:Tmem25 UTSW 9 44,706,811 (GRCm39) unclassified probably benign
R0960:Tmem25 UTSW 9 44,706,809 (GRCm39) critical splice acceptor site probably null
R1204:Tmem25 UTSW 9 44,706,529 (GRCm39) missense probably benign 0.17
R1899:Tmem25 UTSW 9 44,709,513 (GRCm39) splice site probably null
R1927:Tmem25 UTSW 9 44,707,780 (GRCm39) missense possibly damaging 0.77
R2088:Tmem25 UTSW 9 44,707,383 (GRCm39) missense possibly damaging 0.94
R3027:Tmem25 UTSW 9 44,709,511 (GRCm39) splice site probably null
R6854:Tmem25 UTSW 9 44,707,305 (GRCm39) missense possibly damaging 0.46
R7305:Tmem25 UTSW 9 44,706,705 (GRCm39) critical splice donor site probably null
R7655:Tmem25 UTSW 9 44,709,640 (GRCm39) missense possibly damaging 0.82
R7656:Tmem25 UTSW 9 44,709,640 (GRCm39) missense possibly damaging 0.82
R7951:Tmem25 UTSW 9 44,706,790 (GRCm39) missense probably damaging 1.00
R7968:Tmem25 UTSW 9 44,706,983 (GRCm39) missense probably benign 0.00
R8298:Tmem25 UTSW 9 44,710,116 (GRCm39) start gained probably benign
R9177:Tmem25 UTSW 9 44,709,529 (GRCm39) missense possibly damaging 0.95
R9207:Tmem25 UTSW 9 44,710,476 (GRCm39) critical splice donor site probably null
R9274:Tmem25 UTSW 9 44,706,336 (GRCm39) missense probably benign 0.00
R9291:Tmem25 UTSW 9 44,706,799 (GRCm39) missense probably damaging 0.98
R9645:Tmem25 UTSW 9 44,706,515 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TAGTTGCTCACCTGGAGCTGGAAG -3'
(R):5'- TGAATTGATGCTGTACCAGCAGACC -3'

Sequencing Primer
(F):5'- TAGTGACACCCACGTCATTGG -3'
(R):5'- AGCAGACCCTGCTACCTG -3'
Posted On 2013-05-23