Incidental Mutation 'R5111:Nufip2'
ID393868
Institutional Source Beutler Lab
Gene Symbol Nufip2
Ensembl Gene ENSMUSG00000037857
Gene Namenuclear fragile X mental retardation protein interacting protein 2
Synonyms9530056D24Rik, 1110001M19Rik
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77686155-77741921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77691843 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 194 (S194R)
Ref Sequence ENSEMBL: ENSMUSP00000137922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100802] [ENSMUST00000181023]
Predicted Effect probably benign
Transcript: ENSMUST00000100802
AA Change: S194R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098365
Gene: ENSMUSG00000037857
AA Change: S194R

DomainStartEndE-ValueType
low complexity region 7 61 N/A INTRINSIC
Pfam:NUFIP2 90 685 2.4e-292 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155238
Predicted Effect probably benign
Transcript: ENSMUST00000181023
AA Change: S194R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000137922
Gene: ENSMUSG00000037857
AA Change: S194R

DomainStartEndE-ValueType
low complexity region 7 61 N/A INTRINSIC
Pfam:NUFIP2 89 681 7e-293 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Nufip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nufip2 APN 11 77692370 missense possibly damaging 0.93
R0646:Nufip2 UTSW 11 77686453 missense probably benign 0.33
R0667:Nufip2 UTSW 11 77692013 missense possibly damaging 0.94
R1544:Nufip2 UTSW 11 77691907 missense possibly damaging 0.57
R1546:Nufip2 UTSW 11 77691606 missense probably damaging 0.99
R1629:Nufip2 UTSW 11 77693008 missense probably benign 0.03
R1719:Nufip2 UTSW 11 77693090 missense probably damaging 1.00
R1864:Nufip2 UTSW 11 77692298 missense probably damaging 1.00
R3855:Nufip2 UTSW 11 77692889 missense probably damaging 0.97
R4489:Nufip2 UTSW 11 77686229 start codon destroyed probably null
R4584:Nufip2 UTSW 11 77741728 missense unknown
R4585:Nufip2 UTSW 11 77741728 missense unknown
R4586:Nufip2 UTSW 11 77741728 missense unknown
R4779:Nufip2 UTSW 11 77686328 missense unknown
R5354:Nufip2 UTSW 11 77686277 missense unknown
R6051:Nufip2 UTSW 11 77691916 missense probably damaging 1.00
R6324:Nufip2 UTSW 11 77691661 missense probably benign
R6505:Nufip2 UTSW 11 77691613 missense probably benign 0.36
R6941:Nufip2 UTSW 11 77686296 small deletion probably benign
R7237:Nufip2 UTSW 11 77692770 missense probably benign 0.00
R8351:Nufip2 UTSW 11 77692355 missense probably damaging 0.98
R8355:Nufip2 UTSW 11 77692433 missense probably damaging 1.00
R8451:Nufip2 UTSW 11 77692355 missense probably damaging 0.98
R8455:Nufip2 UTSW 11 77692433 missense probably damaging 1.00
Z1176:Nufip2 UTSW 11 77741791 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGGTCCTTAATGGCAACCAG -3'
(R):5'- CTGTTTTAATGCTGGGACACTAGTC -3'

Sequencing Primer
(F):5'- CCAGCAAGTTGTAGAAACAAGCCTG -3'
(R):5'- GGACACTAGTCTCTTGCATTATTTTG -3'
Posted On2016-06-15