Incidental Mutation 'R5111:Krtap16-1'
ID393870
Institutional Source Beutler Lab
Gene Symbol Krtap16-1
Ensembl Gene ENSMUSG00000078253
Gene Namekeratin associated protein 16-1
SynonymsAI450886
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99984710-99986597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99986552 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 9 (K9E)
Ref Sequence ENSEMBL: ENSMUSP00000100671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105050
AA Change: K9E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100671
Gene: ENSMUSG00000078253
AA Change: K9E

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 45 92 3.4e-8 PFAM
Pfam:Keratin_B2_2 88 132 1.8e-11 PFAM
Pfam:Keratin_B2_2 142 191 1.6e-7 PFAM
Pfam:Keratin_B2_2 172 221 9.9e-9 PFAM
Pfam:Keratin_B2_2 198 246 8.2e-5 PFAM
Pfam:Keratin_B2_2 212 266 3.3e-4 PFAM
low complexity region 282 299 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118454
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Krtap16-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Krtap16-1 APN 11 99985731 nonsense probably null
IGL00578:Krtap16-1 APN 11 99985295 missense probably benign 0.00
IGL02324:Krtap16-1 APN 11 99986303 missense probably damaging 0.99
R0200:Krtap16-1 UTSW 11 99985297 missense probably damaging 0.96
R0617:Krtap16-1 UTSW 11 99986495 missense probably damaging 1.00
R1699:Krtap16-1 UTSW 11 99986026 missense probably damaging 1.00
R1785:Krtap16-1 UTSW 11 99985776 nonsense probably null
R2130:Krtap16-1 UTSW 11 99985776 nonsense probably null
R2177:Krtap16-1 UTSW 11 99986449 missense probably damaging 0.99
R4455:Krtap16-1 UTSW 11 99985733 missense probably benign 0.44
R4716:Krtap16-1 UTSW 11 99985174 missense probably damaging 0.99
R5122:Krtap16-1 UTSW 11 99985697 missense probably damaging 0.96
R5254:Krtap16-1 UTSW 11 99985598 nonsense probably null
R5481:Krtap16-1 UTSW 11 99985327 missense probably damaging 0.98
R6557:Krtap16-1 UTSW 11 99985130 missense possibly damaging 0.90
R6884:Krtap16-1 UTSW 11 99986458 nonsense probably null
R7085:Krtap16-1 UTSW 11 99986285 missense possibly damaging 0.56
R7675:Krtap16-1 UTSW 11 99985433 missense possibly damaging 0.52
Z1176:Krtap16-1 UTSW 11 99985597 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCACAGAACAAGAGGGCTC -3'
(R):5'- TAAGATGTTCCTCCAGAAACAGG -3'

Sequencing Primer
(F):5'- AGGGCTCACAAATGGTAGCCTC -3'
(R):5'- CAGGGCCCAAACAACAATGAGG -3'
Posted On2016-06-15