Incidental Mutation 'R5111:Elp3'
ID393873
Institutional Source Beutler Lab
Gene Symbol Elp3
Ensembl Gene ENSMUSG00000022031
Gene Nameelongator acetyltransferase complex subunit 3
SynonymsKAT9, 2610507P14Rik
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5111 (G1)
Quality Score203
Status Validated
Chromosome14
Chromosomal Location65530449-65593075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65560236 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 329 (Y329D)
Ref Sequence ENSEMBL: ENSMUSP00000153462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022609] [ENSMUST00000224743] [ENSMUST00000225355]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022609
AA Change: Y348D

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022609
Gene: ENSMUSG00000022031
AA Change: Y348D

DomainStartEndE-ValueType
Elp3 108 370 1.36e-37 SMART
Blast:Elp3 387 431 2e-19 BLAST
Pfam:Acetyltransf_1 460 555 1.1e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224743
AA Change: Y329D

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000225355
AA Change: Y329D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7907 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ELP3 is the catalytic subunit of the histone acetyltransferase elongator complex, which contributes to transcript elongation and also regulates the maturation of projection neurons (Creppe et al., 2009 [PubMed 19185337]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Embryos homozygous for a null gene trap mutation show severe growth retardation and die prior to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Elp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02477:Elp3 APN 14 65563311 missense probably benign
R0052:Elp3 UTSW 14 65531526 makesense probably null
R0333:Elp3 UTSW 14 65590593 missense probably benign 0.05
R0513:Elp3 UTSW 14 65563246 splice site probably null
R0980:Elp3 UTSW 14 65577953 missense probably damaging 1.00
R1137:Elp3 UTSW 14 65547921 missense probably damaging 0.99
R1259:Elp3 UTSW 14 65547939 missense probably damaging 0.96
R1378:Elp3 UTSW 14 65592931 missense probably benign
R1722:Elp3 UTSW 14 65551397 missense probably benign 0.02
R1789:Elp3 UTSW 14 65547919 missense probably damaging 1.00
R3843:Elp3 UTSW 14 65565483 splice site probably null
R4125:Elp3 UTSW 14 65560181 missense possibly damaging 0.64
R4196:Elp3 UTSW 14 65548002 missense probably damaging 1.00
R4400:Elp3 UTSW 14 65548090 missense possibly damaging 0.89
R4420:Elp3 UTSW 14 65580791 missense probably damaging 1.00
R4516:Elp3 UTSW 14 65547877 missense possibly damaging 0.46
R4764:Elp3 UTSW 14 65582929 missense probably damaging 1.00
R4838:Elp3 UTSW 14 65547864 critical splice donor site probably null
R5052:Elp3 UTSW 14 65577940 missense probably damaging 1.00
R5665:Elp3 UTSW 14 65551402 missense possibly damaging 0.80
R5702:Elp3 UTSW 14 65577982 missense probably damaging 1.00
R5754:Elp3 UTSW 14 65547990 missense probably damaging 1.00
R5927:Elp3 UTSW 14 65582177 missense probably damaging 1.00
R5999:Elp3 UTSW 14 65531540 missense probably benign 0.01
R6378:Elp3 UTSW 14 65592971 nonsense probably null
R6384:Elp3 UTSW 14 65560211 missense probably damaging 1.00
R6601:Elp3 UTSW 14 65547039 makesense probably null
R7263:Elp3 UTSW 14 65565333 missense probably damaging 0.98
R7857:Elp3 UTSW 14 65563310 missense probably benign 0.14
R8504:Elp3 UTSW 14 65547911 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCTACACATGGCATTCCTG -3'
(R):5'- TGTACACTTGACAGAAGGGAC -3'

Sequencing Primer
(F):5'- ACACATGGCATTCCTGATATTCTAC -3'
(R):5'- CTTGACAGAAGGGACAGACAGCTC -3'
Posted On2016-06-15