Incidental Mutation 'R5111:Urb1'
ID393876
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90752017 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 2268 (S2268A)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038197] [ENSMUST00000125429] [ENSMUST00000138984] [ENSMUST00000140920]
Predicted Effect probably benign
Transcript: ENSMUST00000038197
SMART Domains Protein: ENSMUSP00000043890
Gene: ENSMUSG00000039956

DomainStartEndE-ValueType
Pfam:MRAP 1 90 1.7e-49 PFAM
low complexity region 115 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125429
Predicted Effect probably benign
Transcript: ENSMUST00000138984
Predicted Effect probably benign
Transcript: ENSMUST00000140920
AA Change: S2268A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: S2268A

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCCTCAGTCACTAGATCTGAC -3'
(R):5'- GGTTTGCTTTCCATCTGAGC -3'

Sequencing Primer
(F):5'- CAGTCACTAGATCTGACTATAAGGGC -3'
(R):5'- AAGTGCGCATCCTAATGGC -3'
Posted On2016-06-15