Incidental Mutation 'R5111:Lnpep'
ID393877
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Nameleucyl/cystinyl aminopeptidase
Synonymsgp160, 4732490P18Rik, 2010309L07Rik, IRAP, vp165
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17521410-17625050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17578610 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 261 (I261T)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041047
AA Change: I261T

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: I261T

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232515
Meta Mutation Damage Score 0.5348 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17531178 missense probably damaging 1.00
IGL02008:Lnpep APN 17 17570957 missense probably benign 0.40
IGL02040:Lnpep APN 17 17544905 missense probably benign 0.13
IGL02392:Lnpep APN 17 17579183 missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17544903 missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17570900 missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17553193 missense probably benign
IGL02947:Lnpep APN 17 17570972 missense probably damaging 1.00
IGL03493:Lnpep APN 17 17579171 missense probably damaging 1.00
I0000:Lnpep UTSW 17 17578971 missense probably damaging 1.00
PIT4504001:Lnpep UTSW 17 17579027 missense probably benign 0.00
R0528:Lnpep UTSW 17 17531132 splice site probably benign
R0535:Lnpep UTSW 17 17571673 missense possibly damaging 0.91
R0540:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R0586:Lnpep UTSW 17 17575396 splice site probably benign
R0607:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R1502:Lnpep UTSW 17 17571644 missense probably damaging 1.00
R1570:Lnpep UTSW 17 17579156 missense probably damaging 1.00
R1733:Lnpep UTSW 17 17553313 missense probably benign 0.00
R1826:Lnpep UTSW 17 17562836 missense probably damaging 1.00
R2015:Lnpep UTSW 17 17579063 missense probably damaging 0.99
R2029:Lnpep UTSW 17 17568399 missense probably damaging 1.00
R4593:Lnpep UTSW 17 17579027 missense probably benign 0.00
R4638:Lnpep UTSW 17 17575307 missense probably damaging 1.00
R4741:Lnpep UTSW 17 17571658 missense probably damaging 1.00
R4919:Lnpep UTSW 17 17578911 missense probably damaging 1.00
R5030:Lnpep UTSW 17 17579309 missense probably damaging 1.00
R5203:Lnpep UTSW 17 17537063 missense probably damaging 1.00
R5320:Lnpep UTSW 17 17546465 missense possibly damaging 0.83
R5419:Lnpep UTSW 17 17566730 missense probably damaging 1.00
R5535:Lnpep UTSW 17 17538694 missense probably benign 0.02
R5680:Lnpep UTSW 17 17579182 nonsense probably null
R6134:Lnpep UTSW 17 17553192 missense probably benign
R6142:Lnpep UTSW 17 17566681 critical splice donor site probably null
R6189:Lnpep UTSW 17 17566739 missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17578983 missense possibly damaging 0.66
R6350:Lnpep UTSW 17 17562809 missense probably benign 0.01
R6357:Lnpep UTSW 17 17552914 missense probably benign 0.00
R6765:Lnpep UTSW 17 17530496 missense probably damaging 1.00
R6794:Lnpep UTSW 17 17531159 missense probably damaging 1.00
R7013:Lnpep UTSW 17 17568363 missense probably benign 0.04
R7208:Lnpep UTSW 17 17552910 nonsense probably null
R7268:Lnpep UTSW 17 17538541 missense probably benign
R7564:Lnpep UTSW 17 17578592 missense probably benign 0.22
R7746:Lnpep UTSW 17 17538562 missense probably benign
R7853:Lnpep UTSW 17 17562847 missense probably benign 0.00
R7881:Lnpep UTSW 17 17566739 missense probably benign 0.01
R8015:Lnpep UTSW 17 17546499 missense probably damaging 1.00
R8070:Lnpep UTSW 17 17538638 missense probably damaging 1.00
X0004:Lnpep UTSW 17 17544812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCTTCATGGAAGGATGG -3'
(R):5'- ACGGGATATCATTCTCCATAGCAC -3'

Sequencing Primer
(F):5'- GCTTCATGGAAGGATGGCAATATTC -3'
(R):5'- GGATATCATTCTCCATAGCACAGGAC -3'
Posted On2016-06-15