Incidental Mutation 'R5111:H2-Ab1'
ID393880
Institutional Source Beutler Lab
Gene Symbol H2-Ab1
Ensembl Gene ENSMUSG00000073421
Gene Namehistocompatibility 2, class II antigen A, beta 1
SynonymsA beta, Abeta, Ia-2, IAb, Rmcs1, I-A, H-2Ab, I-Abeta, Ia2, H2-Ab
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34263209-34269418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34267482 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 172 (S172T)
Ref Sequence ENSEMBL: ENSMUSP00000041008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040828]
PDB Structure
CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION]
Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION]
J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION]
J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION]
14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040828
AA Change: S172T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041008
Gene: ENSMUSG00000073421
AA Change: S172T

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
MHC_II_beta 40 114 1.53e-47 SMART
IGc1 140 211 8.47e-34 SMART
transmembrane domain 228 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174875
Meta Mutation Damage Score 0.6798 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit depletion of mature CD4+ T cells, deficiency in cell-mediated immune responses, and increased susceptibility to viral infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in H2-Ab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:H2-Ab1 APN 17 34267575 missense probably damaging 1.00
IGL01941:H2-Ab1 APN 17 34267434 nonsense probably null
IGL02826:H2-Ab1 APN 17 34264911 missense probably damaging 0.98
R0479:H2-Ab1 UTSW 17 34264968 missense possibly damaging 0.68
R0815:H2-Ab1 UTSW 17 34267354 missense probably damaging 0.99
R0863:H2-Ab1 UTSW 17 34267354 missense probably damaging 0.99
R1796:H2-Ab1 UTSW 17 34267372 missense probably damaging 0.99
R2875:H2-Ab1 UTSW 17 34263312 start codon destroyed probably benign 0.21
R4042:H2-Ab1 UTSW 17 34264860 missense probably benign
R4687:H2-Ab1 UTSW 17 34264809 missense probably damaging 0.99
R4761:H2-Ab1 UTSW 17 34267500 missense probably damaging 0.98
R4787:H2-Ab1 UTSW 17 34267467 missense possibly damaging 0.92
R5155:H2-Ab1 UTSW 17 34267384 missense possibly damaging 0.89
R5194:H2-Ab1 UTSW 17 34269378 utr 3 prime probably benign
R6869:H2-Ab1 UTSW 17 34267563 missense probably damaging 1.00
R7037:H2-Ab1 UTSW 17 34267989 missense probably damaging 0.99
R7054:H2-Ab1 UTSW 17 34263342 missense probably benign 0.41
R7250:H2-Ab1 UTSW 17 34267507 missense probably damaging 1.00
R8295:H2-Ab1 UTSW 17 34264842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCATTCATTCCCACCCTG -3'
(R):5'- CACCTAAAATCCCATGTCATGTGG -3'

Sequencing Primer
(F):5'- GGGAGTCTCCACATTGCCTCAC -3'
(R):5'- CATGTCATGTGGGGCCC -3'
Posted On2016-06-15