Incidental Mutation 'R5112:Sell'
ID393894
Institutional Source Beutler Lab
Gene Symbol Sell
Ensembl Gene ENSMUSG00000026581
Gene Nameselectin, lymphocyte
SynonymsLyam1, CD62L, L-selectin, Ly-m22, LECAM-1, Lyam-1, Ly-22, Lnhr
MMRRC Submission 042700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5112 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location164061982-164084181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164065318 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 34 (H34Q)
Ref Sequence ENSEMBL: ENSMUSP00000142237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027871] [ENSMUST00000097491] [ENSMUST00000192047] [ENSMUST00000195358]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027871
AA Change: H34Q

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027871
Gene: ENSMUSG00000026581
AA Change: H34Q

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
EGF 159 192 6.55e-1 SMART
CCP 197 254 1.09e-11 SMART
CCP 259 316 1.09e-11 SMART
transmembrane domain 333 355 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097491
AA Change: H34Q

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095099
Gene: ENSMUSG00000026581
AA Change: H34Q

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192047
AA Change: H34Q

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142237
Gene: ENSMUSG00000026581
AA Change: H34Q

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195358
SMART Domains Protein: ENSMUSP00000141365
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
Pfam:Sushi 1 31 1.3e-4 PFAM
transmembrane domain 48 70 N/A INTRINSIC
Meta Mutation Damage Score 0.1223 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface adhesion molecule that belongs to a family of adhesion/homing receptors. The encoded protein contains a C-type lectin-like domain, a calcium-binding epidermal growth factor-like domain, and two short complement-like repeats. The gene product is required for binding and subsequent rolling of leucocytes on endothelial cells, facilitating their migration into secondary lymphoid organs and inflammation sites. Single-nucleotide polymorphisms in this gene have been associated with various diseases including immunoglobulin A nephropathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of lymphocyte binding to high endothelial venules of peripheral lymph nodes and defects in leukocyte rolling and neutrophil migration into the peritoneum following an inflammatory stimulus. Tumor cellsurvival is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,877,465 M80K probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acsm5 A G 7: 119,537,279 K358E possibly damaging Het
Adam26a A T 8: 43,568,856 D532E probably benign Het
Adamts19 C T 18: 59,031,804 R993* probably null Het
Akr1c13 A G 13: 4,194,152 K68R possibly damaging Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Amer3 T A 1: 34,587,076 M132K possibly damaging Het
Ankrd2 A G 19: 42,039,887 D38G possibly damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Apc T A 18: 34,316,109 C1985* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Atp13a4 A T 16: 29,409,868 N950K possibly damaging Het
Bcl6 A G 16: 23,972,746 V286A probably benign Het
Brox T A 1: 183,291,977 T79S probably benign Het
C2cd3 A T 7: 100,443,485 I512F possibly damaging Het
Camta1 A G 4: 151,074,054 L542S probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Cd96 A G 16: 46,098,938 M240T probably benign Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Clcn3 G A 8: 60,954,552 H24Y probably benign Het
Col11a2 T C 17: 34,064,088 probably benign Het
Cpsf3 A T 12: 21,291,784 M50L probably benign Het
Csf3 T A 11: 98,702,923 L197Q probably damaging Het
Ctsw T A 19: 5,466,257 D196V probably damaging Het
Dcun1d3 A T 7: 119,858,027 I154K probably damaging Het
Ddr1 T C 17: 35,682,485 T877A probably benign Het
Dnah8 T A 17: 30,731,038 L1944I probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Ephb1 A G 9: 101,971,179 I640T probably damaging Het
Fat1 G A 8: 45,024,282 G2099S probably damaging Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gart A T 16: 91,634,045 D376E probably benign Het
Glyr1 G A 16: 5,018,876 Q475* probably null Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnmt C A 17: 46,726,330 R176L probably damaging Het
Gpr176 A T 2: 118,280,148 V210D possibly damaging Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Hmbox1 A G 14: 64,825,612 Y372H probably damaging Het
Ier2 G T 8: 84,662,732 A7E probably damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Insl6 G A 19: 29,321,596 Q139* probably null Het
Itga2b A T 11: 102,458,191 I729K probably damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Klhl3 G A 13: 58,018,889 S429F probably damaging Het
Lipo2 T C 19: 33,748,465 N129S probably benign Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Ly86 G T 13: 37,375,037 G71C probably damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Mical2 A G 7: 112,320,611 S443G probably damaging Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Myo7b T C 18: 31,983,587 H989R probably damaging Het
Neil2 A G 14: 63,188,460 W154R probably damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr1449 T C 19: 12,934,816 V26A probably benign Het
Olfr1537 A G 9: 39,238,421 M1T probably null Het
Pabpc6 T A 17: 9,669,611 S4C probably damaging Het
Pan2 C T 10: 128,315,595 R835* probably null Het
Parp9 G A 16: 35,964,313 V346I probably damaging Het
Pcbp4 C T 9: 106,460,718 T69M probably damaging Het
Pclo T A 5: 14,677,882 probably benign Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Plce1 G T 19: 38,651,833 V508F probably benign Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Ryr3 A T 2: 112,902,665 V612E probably damaging Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sgip1 G A 4: 102,869,769 D81N probably damaging Het
Slc12a1 A T 2: 125,218,224 I940F possibly damaging Het
Slc25a34 T A 4: 141,621,458 I232L probably benign Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a15 T A 10: 103,389,226 D58E probably benign Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Svep1 G A 4: 58,068,610 Q3059* probably null Het
Syce1l A C 8: 113,651,642 H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 V814A probably damaging Het
Tbx18 T A 9: 87,715,687 I265F probably damaging Het
Thbs2 T C 17: 14,670,590 probably null Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Unc5a T C 13: 55,003,418 probably null Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r80 T A 10: 79,194,458 V706D possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Vwa3a A T 7: 120,783,985 Y603F probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Sell
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Sell APN 1 164065626 missense probably benign 0.04
IGL02466:Sell APN 1 164069063 splice site probably null
IGL02578:Sell APN 1 164065596 missense probably damaging 1.00
IGL03243:Sell APN 1 164065342 missense possibly damaging 0.94
dim_sum UTSW 1 164066201 unclassified probably null
dim_sum2 UTSW 1 164065661 nonsense probably null
R0125:Sell UTSW 1 164072105 splice site probably benign
R0800:Sell UTSW 1 164066201 unclassified probably null
R1900:Sell UTSW 1 164065338 missense probably damaging 1.00
R3848:Sell UTSW 1 164065661 nonsense probably null
R4553:Sell UTSW 1 164072116 missense probably benign 0.08
R4671:Sell UTSW 1 164065473 missense probably damaging 1.00
R4685:Sell UTSW 1 164066260 missense probably damaging 1.00
R4896:Sell UTSW 1 164063062 missense probably benign 0.02
R4970:Sell UTSW 1 164065318 missense possibly damaging 0.75
R6549:Sell UTSW 1 164065629 missense probably damaging 1.00
R7148:Sell UTSW 1 164065607 missense possibly damaging 0.85
R7545:Sell UTSW 1 164065334 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CTATATTCTGATCCAAGGCTGCC -3'
(R):5'- AGAGTTTTGTTGGTTCCCACCC -3'

Sequencing Primer
(F):5'- CTGCCAACAGCTAATTTGGG -3'
(R):5'- CAATTTTCCTGATTCCTATCCAGTAG -3'
Posted On2016-06-15