Mutagenetix > Incidental Mutations

Incidental Mutation 'R5112:Notch2'

393910

Institutional Source

Beutler Lab

Gene Symbol

Notch2

Ensembl Gene

ENSMUSG00000027878

Gene Name

notch 2

Synonyms

N2, Motch B

MMRRC Submission

042700-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5112 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98013527-98150361 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 98101636 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000078741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079812] [ENSMUST00000079812]

Predicted Effect

probably null
Transcript: ENSMUST00000079812

SMART Domains

Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	27	63	5.79e-2	SMART
EGF	67	102	1.54e-6	SMART
EGF	108	143	6.25e-7	SMART
EGF	147	180	5.28e-5	SMART
EGF_CA	182	219	6.14e-15	SMART
EGF	224	258	5.08e-7	SMART
EGF_CA	260	296	1.95e-8	SMART
EGF_CA	298	336	3.91e-8	SMART
EGF_CA	338	374	7.69e-7	SMART
EGF	378	413	6.86e-4	SMART
EGF_CA	415	454	4.15e-12	SMART
EGF_CA	456	492	3.24e-14	SMART
EGF_CA	494	530	4.77e-12	SMART
EGF_CA	532	568	2.04e-11	SMART
EGF_CA	570	605	1.18e-7	SMART
EGF_CA	607	643	7.12e-11	SMART
EGF_CA	645	680	1.82e-8	SMART
EGF_CA	682	718	1.42e-10	SMART
EGF_CA	720	755	1.25e-6	SMART
EGF_CA	757	793	3.61e-12	SMART
EGF_CA	795	831	1.53e-10	SMART
EGF	836	871	1.34e-6	SMART
EGF_CA	873	909	6.05e-14	SMART
EGF_CA	911	947	9.54e-12	SMART
EGF_CA	949	985	1.39e-13	SMART
EGF_CA	987	1023	1.26e-11	SMART
EGF_CA	1025	1061	9.31e-15	SMART
EGF	1066	1099	1.39e-4	SMART
EGF	1104	1147	2.6e-4	SMART
EGF_CA	1149	1185	1.55e-11	SMART
EGF_CA	1187	1223	2.74e-12	SMART
EGF_CA	1225	1262	4.15e-12	SMART
EGF	1267	1302	1.43e-1	SMART
EGF	1307	1343	2.33e-6	SMART
EGF	1377	1412	9.85e-5	SMART
NL	1418	1456	8.55e-19	SMART
NL	1459	1497	2.27e-14	SMART
NL	1498	1535	1.16e-11	SMART
NOD	1539	1595	3.4e-28	SMART
NODP	1619	1679	1.66e-22	SMART
transmembrane domain	1680	1702	N/A	INTRINSIC
ANK	1828	1872	2.18e2	SMART
ANK	1877	1906	3.36e-2	SMART
ANK	1910	1940	1.81e2	SMART
ANK	1944	1973	6.61e-1	SMART
ANK	1977	2006	5.24e-4	SMART
ANK	2010	2039	3.41e-3	SMART
low complexity region	2179	2193	N/A	INTRINSIC
low complexity region	2232	2241	N/A	INTRINSIC
DUF3454	2382	2447	4.62e-30	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079812

SMART Domains

Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	27	63	5.79e-2	SMART
EGF	67	102	1.54e-6	SMART
EGF	108	143	6.25e-7	SMART
EGF	147	180	5.28e-5	SMART
EGF_CA	182	219	6.14e-15	SMART
EGF	224	258	5.08e-7	SMART
EGF_CA	260	296	1.95e-8	SMART
EGF_CA	298	336	3.91e-8	SMART
EGF_CA	338	374	7.69e-7	SMART
EGF	378	413	6.86e-4	SMART
EGF_CA	415	454	4.15e-12	SMART
EGF_CA	456	492	3.24e-14	SMART
EGF_CA	494	530	4.77e-12	SMART
EGF_CA	532	568	2.04e-11	SMART
EGF_CA	570	605	1.18e-7	SMART
EGF_CA	607	643	7.12e-11	SMART
EGF_CA	645	680	1.82e-8	SMART
EGF_CA	682	718	1.42e-10	SMART
EGF_CA	720	755	1.25e-6	SMART
EGF_CA	757	793	3.61e-12	SMART
EGF_CA	795	831	1.53e-10	SMART
EGF	836	871	1.34e-6	SMART
EGF_CA	873	909	6.05e-14	SMART
EGF_CA	911	947	9.54e-12	SMART
EGF_CA	949	985	1.39e-13	SMART
EGF_CA	987	1023	1.26e-11	SMART
EGF_CA	1025	1061	9.31e-15	SMART
EGF	1066	1099	1.39e-4	SMART
EGF	1104	1147	2.6e-4	SMART
EGF_CA	1149	1185	1.55e-11	SMART
EGF_CA	1187	1223	2.74e-12	SMART
EGF_CA	1225	1262	4.15e-12	SMART
EGF	1267	1302	1.43e-1	SMART
EGF	1307	1343	2.33e-6	SMART
EGF	1377	1412	9.85e-5	SMART
NL	1418	1456	8.55e-19	SMART
NL	1459	1497	2.27e-14	SMART
NL	1498	1535	1.16e-11	SMART
NOD	1539	1595	3.4e-28	SMART
NODP	1619	1679	1.66e-22	SMART
transmembrane domain	1680	1702	N/A	INTRINSIC
ANK	1828	1872	2.18e2	SMART
ANK	1877	1906	3.36e-2	SMART
ANK	1910	1940	1.81e2	SMART
ANK	1944	1973	6.61e-1	SMART
ANK	1977	2006	5.24e-4	SMART
ANK	2010	2039	3.41e-3	SMART
low complexity region	2179	2193	N/A	INTRINSIC
low complexity region	2232	2241	N/A	INTRINSIC
DUF3454	2382	2447	4.62e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198324

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,877,465	M80K	probably benign	Het
Abca2	A	G	2: 25,438,371	K846R	probably damaging	Het
Acsm5	A	G	7: 119,537,279	K358E	possibly damaging	Het
Adam26a	A	T	8: 43,568,856	D532E	probably benign	Het
Adamts19	C	T	18: 59,031,804	R993*	probably null	Het
Akr1c13	A	G	13: 4,194,152	K68R	possibly damaging	Het
Als2cr12	T	C	1: 58,659,282	T326A	probably benign	Het
Amer3	T	A	1: 34,587,076	M132K	possibly damaging	Het
Ankrd2	A	G	19: 42,039,887	D38G	possibly damaging	Het
Ano7	G	A	1: 93,397,363	V546M	possibly damaging	Het
Aox2	G	A	1: 58,310,095		probably null	Het
Apc	T	A	18: 34,316,109	C1985*	probably null	Het
Astn1	C	T	1: 158,657,193	S15F	possibly damaging	Het
Atp13a4	A	T	16: 29,409,868	N950K	possibly damaging	Het
Bcl6	A	G	16: 23,972,746	V286A	probably benign	Het
Brox	T	A	1: 183,291,977	T79S	probably benign	Het
C2cd3	A	T	7: 100,443,485	I512F	possibly damaging	Het
Camta1	A	G	4: 151,074,054	L542S	probably damaging	Het
Capn13	GCA	G	17: 73,351,506		probably null	Het
Card10	C	T	15: 78,802,380		probably null	Het
Cd96	A	G	16: 46,098,938	M240T	probably benign	Het
Cdc123	A	G	2: 5,804,937	L221P	possibly damaging	Het
Cdh19	A	G	1: 110,954,624	V46A	possibly damaging	Het
Clcn3	G	A	8: 60,954,552	H24Y	probably benign	Het
Col11a2	T	C	17: 34,064,088		probably benign	Het
Cpsf3	A	T	12: 21,291,784	M50L	probably benign	Het
Csf3	T	A	11: 98,702,923	L197Q	probably damaging	Het
Ctsw	T	A	19: 5,466,257	D196V	probably damaging	Het
Dcun1d3	A	T	7: 119,858,027	I154K	probably damaging	Het
Ddr1	T	C	17: 35,682,485	T877A	probably benign	Het
Dnah8	T	A	17: 30,731,038	L1944I	probably benign	Het
Dpf3	G	T	12: 83,370,611	S29*	probably null	Het
Ephb1	A	G	9: 101,971,179	I640T	probably damaging	Het
Fat1	G	A	8: 45,024,282	G2099S	probably damaging	Het
Fbxo41	G	T	6: 85,477,924	N667K	probably damaging	Het
Gart	A	T	16: 91,634,045	D376E	probably benign	Het
Glyr1	G	A	16: 5,018,876	Q475*	probably null	Het
Gm28051	G	A	12: 102,720,171	Q77*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gnmt	C	A	17: 46,726,330	R176L	probably damaging	Het
Gpr176	A	T	2: 118,280,148	V210D	possibly damaging	Het
Gtf2ird1	A	T	5: 134,402,184	D339E	probably damaging	Het
Hmbox1	A	G	14: 64,825,612	Y372H	probably damaging	Het
Ier2	G	T	8: 84,662,732	A7E	probably damaging	Het
Il20ra	A	G	10: 19,758,943	T311A	possibly damaging	Het
Il24	T	C	1: 130,883,442		probably null	Het
Insl6	G	A	19: 29,321,596	Q139*	probably null	Het
Itga2b	A	T	11: 102,458,191	I729K	probably damaging	Het
Itpr2	A	T	6: 146,233,991	M1814K	possibly damaging	Het
Klhl3	G	A	13: 58,018,889	S429F	probably damaging	Het
Lipo2	T	C	19: 33,748,465	N129S	probably benign	Het
Lrba	C	T	3: 86,225,371	T28M	probably benign	Het
Ly86	G	T	13: 37,375,037	G71C	probably damaging	Het
Maob	T	C	X: 16,716,423	T400A	probably benign	Het
Mical2	A	G	7: 112,320,611	S443G	probably damaging	Het
Mmp17	A	G	5: 129,602,165	H376R	possibly damaging	Het
Myo7b	T	C	18: 31,983,587	H989R	probably damaging	Het
Neil2	A	G	14: 63,188,460	W154R	probably damaging	Het
Nlrp12	G	A	7: 3,240,983	H300Y	possibly damaging	Het
Nlrp3	A	T	11: 59,548,728	Y377F	probably damaging	Het
Nudcd1	A	T	15: 44,376,643	C500*	probably null	Het
Olfr1099	A	T	2: 86,959,354	Y35N	probably damaging	Het
Olfr1164	A	G	2: 88,093,009	V309A	probably damaging	Het
Olfr1449	T	C	19: 12,934,816	V26A	probably benign	Het
Olfr1537	A	G	9: 39,238,421	M1T	probably null	Het
Pabpc6	T	A	17: 9,669,611	S4C	probably damaging	Het
Pan2	C	T	10: 128,315,595	R835*	probably null	Het
Parp9	G	A	16: 35,964,313	V346I	probably damaging	Het
Pcbp4	C	T	9: 106,460,718	T69M	probably damaging	Het
Pclo	T	A	5: 14,677,882		probably benign	Het
Phldb3	A	T	7: 24,624,685	I495F	possibly damaging	Het
Plce1	G	T	19: 38,651,833	V508F	probably benign	Het
Pmpca	A	T	2: 26,395,166	I468F	probably damaging	Het
Pmpcb	G	A	5: 21,756,443	R399H	probably damaging	Het
Ptprc	A	G	1: 138,094,299	S544P	probably damaging	Het
Rev3l	T	A	10: 39,823,330	D1274E	probably benign	Het
Ryr3	A	T	2: 112,902,665	V612E	probably damaging	Het
Scfd2	G	T	5: 74,206,321	H639Q	probably benign	Het
Sell	T	A	1: 164,065,318	H34Q	possibly damaging	Het
Setd2	A	G	9: 110,548,158	D347G	probably benign	Het
Sgip1	G	A	4: 102,869,769	D81N	probably damaging	Het
Slc12a1	A	T	2: 125,218,224	I940F	possibly damaging	Het
Slc25a34	T	A	4: 141,621,458	I232L	probably benign	Het
Slc36a3	T	A	11: 55,148,573	K76N	probably damaging	Het
Slc6a15	T	A	10: 103,389,226	D58E	probably benign	Het
Slc6a7	T	C	18: 61,007,376	S195G	probably null	Het
Svep1	G	A	4: 58,068,610	Q3059*	probably null	Het
Syce1l	A	C	8: 113,651,642	H56P	probably damaging	Het
Tbc1d2	A	G	4: 46,606,503	V814A	probably damaging	Het
Tbx18	T	A	9: 87,715,687	I265F	probably damaging	Het
Thbs2	T	C	17: 14,670,590		probably null	Het
Ttll1	T	C	15: 83,496,396	H256R	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttyh2	A	T	11: 114,696,757	T195S	probably benign	Het
Unc119b	A	G	5: 115,125,494	L217P	probably damaging	Het
Unc5a	T	C	13: 55,003,418		probably null	Het
Usp6nl	A	G	2: 6,420,903	K152E	probably benign	Het
Vcam1	T	C	3: 116,117,292	R486G	probably benign	Het
Vmn2r1	A	C	3: 64,090,123	Q400P	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,458	V706D	possibly damaging	Het
Vmn2r87	A	T	10: 130,478,553	L388Q	probably damaging	Het
Vwa3a	A	T	7: 120,783,985	Y603F	probably damaging	Het
Zfp850	A	T	7: 27,990,233	C183*	probably null	Het

Other mutations in Notch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Notch2	APN	3	98111675	missense	possibly damaging	0.77
IGL01517:Notch2	APN	3	98138655	missense	probably benign	0.16
IGL01630:Notch2	APN	3	98146618	missense	possibly damaging	0.77
IGL01637:Notch2	APN	3	98146060	missense	probably damaging	1.00
IGL01828:Notch2	APN	3	98072613	missense	probably damaging	1.00
IGL01998:Notch2	APN	3	98143106	missense	probably damaging	1.00
IGL02008:Notch2	APN	3	98147296	missense	probably damaging	1.00
IGL02030:Notch2	APN	3	98099421	splice site	probably null
IGL02155:Notch2	APN	3	98138490	missense	probably damaging	0.98
IGL02268:Notch2	APN	3	98137397	missense	probably damaging	1.00
IGL02301:Notch2	APN	3	98141554	missense	probably benign	0.08
IGL02336:Notch2	APN	3	98138395	missense	possibly damaging	0.73
IGL02340:Notch2	APN	3	98147336	nonsense	probably null
IGL02536:Notch2	APN	3	98102407	missense	probably benign	0.03
IGL02589:Notch2	APN	3	98104347	critical splice acceptor site	probably null
IGL02633:Notch2	APN	3	98116697	splice site	probably benign
IGL02691:Notch2	APN	3	98135607	nonsense	probably null
IGL02832:Notch2	APN	3	98137373	missense	probably benign	0.12
IGL02894:Notch2	APN	3	98102432	nonsense	probably null
IGL02902:Notch2	APN	3	98111574	missense	probably damaging	1.00
IGL02967:Notch2	APN	3	98146144	missense	probably damaging	0.99
IGL03015:Notch2	APN	3	98072649	missense	possibly damaging	0.83
PIT4378001:Notch2	UTSW	3	98142956	missense	probably damaging	1.00
PIT4519001:Notch2	UTSW	3	98098108	missense	probably damaging	1.00
PIT4581001:Notch2	UTSW	3	98104462	missense	probably damaging	1.00
R0111:Notch2	UTSW	3	98138761	missense	probably benign	0.00
R0129:Notch2	UTSW	3	98146620	missense	probably benign	0.08
R0143:Notch2	UTSW	3	98146117	missense	probably damaging	0.99
R0480:Notch2	UTSW	3	98146537	missense	possibly damaging	0.88
R0523:Notch2	UTSW	3	98070970	missense	probably benign	0.34
R0523:Notch2	UTSW	3	98111598	missense	probably benign	0.00
R0531:Notch2	UTSW	3	98102451	splice site	probably benign
R0537:Notch2	UTSW	3	98116741	missense	possibly damaging	0.70
R0987:Notch2	UTSW	3	98134677	splice site	probably null
R1485:Notch2	UTSW	3	98100257	missense	probably benign	0.00
R1555:Notch2	UTSW	3	98131340	missense	possibly damaging	0.93
R1625:Notch2	UTSW	3	98111575	missense	probably damaging	1.00
R1699:Notch2	UTSW	3	98145127	missense	probably damaging	1.00
R1765:Notch2	UTSW	3	98121926	missense	probably damaging	1.00
R1794:Notch2	UTSW	3	98099547	missense	possibly damaging	0.53
R1974:Notch2	UTSW	3	98072755	missense	probably damaging	1.00
R2086:Notch2	UTSW	3	98102367	missense	probably damaging	1.00
R2099:Notch2	UTSW	3	98115321	missense	possibly damaging	0.79
R3778:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R3924:Notch2	UTSW	3	98122034	nonsense	probably null
R4018:Notch2	UTSW	3	98104565	missense	probably damaging	1.00
R4151:Notch2	UTSW	3	98147071	missense	possibly damaging	0.95
R4417:Notch2	UTSW	3	98131270	missense	possibly damaging	0.95
R4510:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4511:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4636:Notch2	UTSW	3	98146104	missense	probably benign	0.02
R4661:Notch2	UTSW	3	98135513	missense	probably damaging	1.00
R4856:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4886:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4945:Notch2	UTSW	3	98111721	missense	probably benign	0.01
R4970:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R4974:Notch2	UTSW	3	98139633	missense	probably benign	0.39
R5082:Notch2	UTSW	3	98100374	missense	probably damaging	1.00
R5156:Notch2	UTSW	3	98124310	missense	possibly damaging	0.53
R5433:Notch2	UTSW	3	98126134	missense	probably damaging	1.00
R5539:Notch2	UTSW	3	98137582	missense	probably damaging	0.99
R5813:Notch2	UTSW	3	98135428	missense	probably benign
R5827:Notch2	UTSW	3	98072862	missense	possibly damaging	0.64
R5908:Notch2	UTSW	3	98123923	intron	probably benign
R6021:Notch2	UTSW	3	98121972	missense	probably damaging	1.00
R6090:Notch2	UTSW	3	98135377	nonsense	probably null
R6103:Notch2	UTSW	3	98135743	missense	possibly damaging	0.94
R6111:Notch2	UTSW	3	98146293	missense	probably benign	0.00
R6168:Notch2	UTSW	3	98145217	missense	probably damaging	1.00
R6382:Notch2	UTSW	3	98141543	missense	probably damaging	1.00
R6404:Notch2	UTSW	3	98081998	missense	probably damaging	1.00
R6419:Notch2	UTSW	3	98100389	critical splice donor site	probably null
R6454:Notch2	UTSW	3	98137406	missense	possibly damaging	0.47
R6626:Notch2	UTSW	3	98101605	missense	probably damaging	1.00
R6629:Notch2	UTSW	3	98120881	missense	possibly damaging	0.65
R6706:Notch2	UTSW	3	98138430	missense	possibly damaging	0.94
R6735:Notch2	UTSW	3	98134586	missense	probably damaging	1.00
R6837:Notch2	UTSW	3	98070854	splice site	probably null
R7021:Notch2	UTSW	3	98135446	missense	probably benign
R7028:Notch2	UTSW	3	98102387	missense	probably damaging	1.00
R7228:Notch2	UTSW	3	98137317	nonsense	probably null
R7320:Notch2	UTSW	3	98131327	missense	possibly damaging	0.94
R7361:Notch2	UTSW	3	98131402	missense	probably benign	0.04
R7562:Notch2	UTSW	3	98113114	missense	probably damaging	1.00
R7630:Notch2	UTSW	3	98137508	missense	possibly damaging	0.65
R7637:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R7748:Notch2	UTSW	3	98138484	missense	possibly damaging	0.69
R7764:Notch2	UTSW	3	98142988	missense	probably damaging	1.00
R7817:Notch2	UTSW	3	98107127	missense	probably damaging	1.00
R7952:Notch2	UTSW	3	98100236	missense	probably benign	0.30
R8136:Notch2	UTSW	3	98124221	missense	probably damaging	1.00
R8159:Notch2	UTSW	3	98120922	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCTTTGGAGAGCTGCTCATG -3'
(R):5'- CATGCTGGCTGAAACAGTTCC -3'

Sequencing Primer
(F):5'- AGAGCTGCTCATGCTTGC -3'
(R):5'- TGGCTGAAACAGTTCCCCACC -3'

Posted On

2016-06-15