Incidental Mutation 'R5112:Svep1'
ID393912
Institutional Source Beutler Lab
Gene Symbol Svep1
Ensembl Gene ENSMUSG00000028369
Gene Namesushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
SynonymsD430029O09Rik, 4833413O10Rik, Polydom, 1110021D17Rik
MMRRC Submission 042700-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5112 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58042442-58206859 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 58068610 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 3059 (Q3059*)
Ref Sequence ENSEMBL: ENSMUSP00000045856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042850]
Predicted Effect probably null
Transcript: ENSMUST00000042850
AA Change: Q3059*
SMART Domains Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: Q3059*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 51 60 N/A INTRINSIC
VWA 82 261 2.18e-32 SMART
Pfam:GCC2_GCC3 311 361 3.4e-14 PFAM
CCP 379 434 3.62e-8 SMART
CCP 439 494 1.78e-16 SMART
CCP 499 559 2.13e-5 SMART
Pfam:HYR 560 642 1.7e-20 PFAM
Pfam:HYR 643 722 4.6e-15 PFAM
CCP 727 787 3.59e-1 SMART
low complexity region 862 873 N/A INTRINSIC
Pfam:GCC2_GCC3 1004 1051 3.2e-16 PFAM
Pfam:GCC2_GCC3 1058 1105 5.4e-19 PFAM
Pfam:GCC2_GCC3 1112 1159 7.7e-19 PFAM
EGF 1195 1228 3.12e-7 SMART
EGF_CA 1230 1266 3.93e-13 SMART
EGF_CA 1268 1304 8.3e-12 SMART
EGF_CA 1306 1342 4.59e-14 SMART
EGF_CA 1344 1380 8.69e-15 SMART
EGF_CA 1382 1418 3.42e-13 SMART
Pfam:Pentaxin 1429 1622 1.8e-28 PFAM
Pfam:Laminin_G_3 1432 1589 1.1e-20 PFAM
CCP 1630 1684 1.71e-9 SMART
CCP 1689 1742 2.31e-15 SMART
EGF_CA 1744 1783 5.23e-9 SMART
CCP 1788 1841 4.62e-15 SMART
CCP 1846 1899 8.29e-17 SMART
CCP 1904 1957 1.1e-12 SMART
CCP 1962 2015 5.6e-14 SMART
CCP 2020 2077 4.15e-8 SMART
CCP 2082 2140 8.11e-11 SMART
CCP 2145 2198 4.38e-16 SMART
CCP 2203 2258 1.69e-8 SMART
CCP 2263 2317 1.42e-15 SMART
CCP 2322 2375 3.1e-7 SMART
CCP 2380 2434 4.55e-14 SMART
CCP 2439 2492 6.95e-10 SMART
CCP 2497 2550 8.88e-17 SMART
CCP 2555 2607 1.7e-13 SMART
CCP 2651 2709 1.02e-7 SMART
CCP 2714 2767 9.6e-13 SMART
CCP 2772 2825 3.64e-13 SMART
CCP 2830 2883 6.63e-16 SMART
CCP 2888 2941 2.76e-13 SMART
CCP 2946 2999 4.41e-12 SMART
CCP 3004 3055 4.25e-5 SMART
CCP 3060 3113 5.15e-13 SMART
CCP 3118 3172 2.11e-9 SMART
CCP 3177 3232 1.02e-7 SMART
CCP 3237 3290 6.19e-16 SMART
CCP 3295 3348 5.35e-11 SMART
CCP 3353 3407 8.43e-9 SMART
CCP 3412 3464 2.44e-14 SMART
EGF 3467 3496 1.28e-3 SMART
EGF 3499 3528 1.15e-5 SMART
EGF 3531 3560 2.85e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,877,465 M80K probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acsm5 A G 7: 119,537,279 K358E possibly damaging Het
Adam26a A T 8: 43,568,856 D532E probably benign Het
Adamts19 C T 18: 59,031,804 R993* probably null Het
Akr1c13 A G 13: 4,194,152 K68R possibly damaging Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Amer3 T A 1: 34,587,076 M132K possibly damaging Het
Ankrd2 A G 19: 42,039,887 D38G possibly damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Apc T A 18: 34,316,109 C1985* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Atp13a4 A T 16: 29,409,868 N950K possibly damaging Het
Bcl6 A G 16: 23,972,746 V286A probably benign Het
Brox T A 1: 183,291,977 T79S probably benign Het
C2cd3 A T 7: 100,443,485 I512F possibly damaging Het
Camta1 A G 4: 151,074,054 L542S probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Cd96 A G 16: 46,098,938 M240T probably benign Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Clcn3 G A 8: 60,954,552 H24Y probably benign Het
Col11a2 T C 17: 34,064,088 probably benign Het
Cpsf3 A T 12: 21,291,784 M50L probably benign Het
Csf3 T A 11: 98,702,923 L197Q probably damaging Het
Ctsw T A 19: 5,466,257 D196V probably damaging Het
Dcun1d3 A T 7: 119,858,027 I154K probably damaging Het
Ddr1 T C 17: 35,682,485 T877A probably benign Het
Dnah8 T A 17: 30,731,038 L1944I probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Ephb1 A G 9: 101,971,179 I640T probably damaging Het
Fat1 G A 8: 45,024,282 G2099S probably damaging Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gart A T 16: 91,634,045 D376E probably benign Het
Glyr1 G A 16: 5,018,876 Q475* probably null Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnmt C A 17: 46,726,330 R176L probably damaging Het
Gpr176 A T 2: 118,280,148 V210D possibly damaging Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Hmbox1 A G 14: 64,825,612 Y372H probably damaging Het
Ier2 G T 8: 84,662,732 A7E probably damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Insl6 G A 19: 29,321,596 Q139* probably null Het
Itga2b A T 11: 102,458,191 I729K probably damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Klhl3 G A 13: 58,018,889 S429F probably damaging Het
Lipo2 T C 19: 33,748,465 N129S probably benign Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Ly86 G T 13: 37,375,037 G71C probably damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Mical2 A G 7: 112,320,611 S443G probably damaging Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Myo7b T C 18: 31,983,587 H989R probably damaging Het
Neil2 A G 14: 63,188,460 W154R probably damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr1449 T C 19: 12,934,816 V26A probably benign Het
Olfr1537 A G 9: 39,238,421 M1T probably null Het
Pabpc6 T A 17: 9,669,611 S4C probably damaging Het
Pan2 C T 10: 128,315,595 R835* probably null Het
Parp9 G A 16: 35,964,313 V346I probably damaging Het
Pcbp4 C T 9: 106,460,718 T69M probably damaging Het
Pclo T A 5: 14,677,882 probably benign Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Plce1 G T 19: 38,651,833 V508F probably benign Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Ryr3 A T 2: 112,902,665 V612E probably damaging Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sgip1 G A 4: 102,869,769 D81N probably damaging Het
Slc12a1 A T 2: 125,218,224 I940F possibly damaging Het
Slc25a34 T A 4: 141,621,458 I232L probably benign Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a15 T A 10: 103,389,226 D58E probably benign Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Syce1l A C 8: 113,651,642 H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 V814A probably damaging Het
Tbx18 T A 9: 87,715,687 I265F probably damaging Het
Thbs2 T C 17: 14,670,590 probably null Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Unc5a T C 13: 55,003,418 probably null Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r80 T A 10: 79,194,458 V706D possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Vwa3a A T 7: 120,783,985 Y603F probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Svep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Svep1 APN 4 58176077 missense probably damaging 0.98
IGL00489:Svep1 APN 4 58068988 missense possibly damaging 0.71
IGL00496:Svep1 APN 4 58069001 missense possibly damaging 0.95
IGL00864:Svep1 APN 4 58068533 nonsense probably null
IGL00904:Svep1 APN 4 58097398 missense probably benign 0.00
IGL00935:Svep1 APN 4 58090664 missense possibly damaging 0.71
IGL00963:Svep1 APN 4 58072791 nonsense probably null
IGL01077:Svep1 APN 4 58068760 missense possibly damaging 0.71
IGL01084:Svep1 APN 4 58111419 missense possibly damaging 0.71
IGL01150:Svep1 APN 4 58070302 missense probably benign 0.04
IGL01161:Svep1 APN 4 58146569 missense probably damaging 0.96
IGL01360:Svep1 APN 4 58116554 missense possibly damaging 0.73
IGL01365:Svep1 APN 4 58100878 critical splice acceptor site probably null
IGL01396:Svep1 APN 4 58068552 missense possibly damaging 0.85
IGL01601:Svep1 APN 4 58084872 missense probably damaging 1.00
IGL01636:Svep1 APN 4 58116622 missense possibly damaging 0.96
IGL01838:Svep1 APN 4 58121910 missense possibly damaging 0.72
IGL01949:Svep1 APN 4 58176006 missense probably damaging 1.00
IGL01984:Svep1 APN 4 58068877 missense possibly damaging 0.93
IGL02005:Svep1 APN 4 58069056 missense possibly damaging 0.93
IGL02036:Svep1 APN 4 58088245 missense possibly damaging 0.85
IGL02039:Svep1 APN 4 58123980 critical splice donor site probably null
IGL02043:Svep1 APN 4 58068556 missense probably benign 0.19
IGL02073:Svep1 APN 4 58070104 missense probably benign 0.06
IGL02188:Svep1 APN 4 58068382 missense possibly damaging 0.71
IGL02256:Svep1 APN 4 58070311 missense possibly damaging 0.71
IGL02284:Svep1 APN 4 58072819 missense probably benign 0.32
IGL02323:Svep1 APN 4 58070236 nonsense probably null
IGL02440:Svep1 APN 4 58145293 missense probably benign 0.06
IGL02449:Svep1 APN 4 58070296 missense possibly damaging 0.71
IGL02501:Svep1 APN 4 58145341 splice site probably benign
IGL02568:Svep1 APN 4 58135441 missense probably benign 0.42
IGL02625:Svep1 APN 4 58115807 missense possibly damaging 0.53
IGL02795:Svep1 APN 4 58123223 missense probably damaging 1.00
IGL02818:Svep1 APN 4 58069804 missense possibly damaging 0.71
IGL02871:Svep1 APN 4 58100871 missense probably benign
IGL02875:Svep1 APN 4 58082821 splice site probably benign
IGL02887:Svep1 APN 4 58145301 missense probably damaging 1.00
IGL03240:Svep1 APN 4 58048188 missense possibly damaging 0.73
IGL03243:Svep1 APN 4 58133387 missense probably benign 0.06
IGL03264:Svep1 APN 4 58066422 splice site probably benign
IGL03288:Svep1 APN 4 58116532 missense probably benign 0.01
IGL03340:Svep1 APN 4 58111451 missense possibly damaging 0.96
IGL03341:Svep1 APN 4 58070308 nonsense probably null
IGL03348:Svep1 APN 4 58113635 missense probably damaging 1.00
R0001:Svep1 UTSW 4 58066460 missense possibly damaging 0.93
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0125:Svep1 UTSW 4 58099937 splice site probably benign
R0142:Svep1 UTSW 4 58118232 missense probably benign 0.33
R0147:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0148:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0157:Svep1 UTSW 4 58069830 missense possibly damaging 0.72
R0195:Svep1 UTSW 4 58089514 missense possibly damaging 0.82
R0197:Svep1 UTSW 4 58070851 missense possibly damaging 0.71
R0257:Svep1 UTSW 4 58179610 missense possibly damaging 0.71
R0314:Svep1 UTSW 4 58096331 missense possibly damaging 0.71
R0316:Svep1 UTSW 4 58072737 missense probably damaging 0.98
R0322:Svep1 UTSW 4 58057996 splice site probably benign
R0426:Svep1 UTSW 4 58073333 missense possibly damaging 0.87
R0446:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R0457:Svep1 UTSW 4 58118136 missense probably damaging 1.00
R0471:Svep1 UTSW 4 58054700 missense possibly damaging 0.85
R0555:Svep1 UTSW 4 58128858 missense possibly damaging 0.71
R0634:Svep1 UTSW 4 58070661 missense possibly damaging 0.86
R0636:Svep1 UTSW 4 58073121 nonsense probably null
R0827:Svep1 UTSW 4 58053113 splice site probably benign
R1025:Svep1 UTSW 4 58087817 missense possibly damaging 0.86
R1027:Svep1 UTSW 4 58094084 missense possibly damaging 0.86
R1069:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1161:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1245:Svep1 UTSW 4 58066427 critical splice donor site probably null
R1282:Svep1 UTSW 4 58100032 missense possibly damaging 0.93
R1310:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1444:Svep1 UTSW 4 58115754 missense possibly damaging 0.53
R1460:Svep1 UTSW 4 58068740 missense possibly damaging 0.85
R1500:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1628:Svep1 UTSW 4 58107561 missense probably benign 0.00
R1712:Svep1 UTSW 4 58070629 missense probably benign 0.06
R1774:Svep1 UTSW 4 58146562 missense possibly damaging 0.92
R1783:Svep1 UTSW 4 58073333 missense probably benign
R1829:Svep1 UTSW 4 58096310 missense possibly damaging 0.93
R1978:Svep1 UTSW 4 58097292 missense possibly damaging 0.73
R1993:Svep1 UTSW 4 58064170 critical splice donor site probably null
R2017:Svep1 UTSW 4 58070568 missense probably benign 0.08
R2058:Svep1 UTSW 4 58084554 missense possibly damaging 0.92
R2109:Svep1 UTSW 4 58206030 missense possibly damaging 0.51
R2215:Svep1 UTSW 4 58138602 splice site probably benign
R2281:Svep1 UTSW 4 58082677 missense possibly damaging 0.85
R2504:Svep1 UTSW 4 58135628 splice site probably null
R2763:Svep1 UTSW 4 58084061 missense possibly damaging 0.86
R3122:Svep1 UTSW 4 58087845 missense possibly damaging 0.51
R3605:Svep1 UTSW 4 58066542 missense probably benign 0.32
R3763:Svep1 UTSW 4 58084833 missense possibly damaging 0.89
R3827:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3829:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3830:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3910:Svep1 UTSW 4 58145156 critical splice donor site probably null
R3943:Svep1 UTSW 4 58084807 splice site probably null
R3944:Svep1 UTSW 4 58084807 splice site probably null
R4153:Svep1 UTSW 4 58089426 missense possibly damaging 0.52
R4154:Svep1 UTSW 4 58069068 missense possibly damaging 0.71
R4191:Svep1 UTSW 4 58046601 missense possibly damaging 0.86
R4355:Svep1 UTSW 4 58138695 missense possibly damaging 0.71
R4388:Svep1 UTSW 4 58069249 missense possibly damaging 0.93
R4532:Svep1 UTSW 4 58068886 missense possibly damaging 0.52
R4584:Svep1 UTSW 4 58068526 nonsense probably null
R4592:Svep1 UTSW 4 58084028 missense possibly damaging 0.93
R4593:Svep1 UTSW 4 58091944 missense possibly damaging 0.71
R4625:Svep1 UTSW 4 58072698 missense probably damaging 0.98
R4639:Svep1 UTSW 4 58082724 missense probably benign
R4700:Svep1 UTSW 4 58097323 missense possibly damaging 0.71
R4720:Svep1 UTSW 4 58205869 missense possibly damaging 0.71
R4724:Svep1 UTSW 4 58070752 missense possibly damaging 0.71
R4753:Svep1 UTSW 4 58053212 missense probably benign 0.06
R4781:Svep1 UTSW 4 58070340 missense probably damaging 0.98
R4820:Svep1 UTSW 4 58082664 missense probably benign 0.27
R4896:Svep1 UTSW 4 58087751 missense probably benign 0.08
R4905:Svep1 UTSW 4 58069308 missense probably benign 0.00
R4910:Svep1 UTSW 4 58096276 missense possibly damaging 0.71
R4972:Svep1 UTSW 4 58087778 missense possibly damaging 0.71
R5004:Svep1 UTSW 4 58087751 missense probably benign 0.08
R5088:Svep1 UTSW 4 58120648 missense possibly damaging 0.73
R5185:Svep1 UTSW 4 58084534 missense probably damaging 0.99
R5302:Svep1 UTSW 4 58096183 missense possibly damaging 0.71
R5307:Svep1 UTSW 4 58072677 missense possibly damaging 0.71
R5339:Svep1 UTSW 4 58121892 missense possibly damaging 0.96
R5379:Svep1 UTSW 4 58072991 missense possibly damaging 0.51
R5384:Svep1 UTSW 4 58104545 missense possibly damaging 0.71
R5414:Svep1 UTSW 4 58206322 missense possibly damaging 0.53
R5514:Svep1 UTSW 4 58044054 missense possibly damaging 0.53
R5538:Svep1 UTSW 4 58049282 critical splice acceptor site probably null
R5549:Svep1 UTSW 4 58057954 missense probably benign 0.32
R5618:Svep1 UTSW 4 58070537 missense probably benign
R5623:Svep1 UTSW 4 58091964 missense possibly damaging 0.92
R5686:Svep1 UTSW 4 58072826 missense possibly damaging 0.71
R5743:Svep1 UTSW 4 58096223 missense possibly damaging 0.71
R5773:Svep1 UTSW 4 58099985 missense possibly damaging 0.86
R5809:Svep1 UTSW 4 58116524 missense possibly damaging 0.73
R5896:Svep1 UTSW 4 58084906 missense possibly damaging 0.71
R5918:Svep1 UTSW 4 58069345 missense possibly damaging 0.71
R5969:Svep1 UTSW 4 58070977 nonsense probably null
R6010:Svep1 UTSW 4 58115832 missense possibly damaging 0.95
R6187:Svep1 UTSW 4 58072872 missense probably damaging 1.00
R6192:Svep1 UTSW 4 58104536 missense possibly damaging 0.92
R6209:Svep1 UTSW 4 58128869 missense probably benign 0.32
R6234:Svep1 UTSW 4 58113458 intron probably null
R6326:Svep1 UTSW 4 58073045 missense possibly damaging 0.51
R6400:Svep1 UTSW 4 58049169 missense probably damaging 1.00
R6418:Svep1 UTSW 4 58053126 missense probably benign 0.01
R6440:Svep1 UTSW 4 58116555 missense possibly damaging 0.53
R6489:Svep1 UTSW 4 58100066 missense probably damaging 1.00
R6515:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R6738:Svep1 UTSW 4 58123180 missense possibly damaging 0.71
R6773:Svep1 UTSW 4 58049146 missense possibly damaging 0.71
R6796:Svep1 UTSW 4 58064275 missense probably benign 0.01
R7055:Svep1 UTSW 4 58064275 missense probably benign 0.19
R7055:Svep1 UTSW 4 58120642 missense probably benign 0.33
R7111:Svep1 UTSW 4 58118207 missense possibly damaging 0.70
R7161:Svep1 UTSW 4 58128859 missense possibly damaging 0.93
R7162:Svep1 UTSW 4 58070262 missense possibly damaging 0.71
R7182:Svep1 UTSW 4 58043991 missense probably benign 0.18
R7292:Svep1 UTSW 4 58111395 missense possibly damaging 0.71
R7299:Svep1 UTSW 4 58046587 nonsense probably null
R7301:Svep1 UTSW 4 58046587 nonsense probably null
R7316:Svep1 UTSW 4 58068763 missense possibly damaging 0.71
R7337:Svep1 UTSW 4 58108323 missense probably damaging 0.98
R7391:Svep1 UTSW 4 58145185 missense probably damaging 0.98
R7402:Svep1 UTSW 4 58069699 missense possibly damaging 0.71
R7445:Svep1 UTSW 4 58094122 missense possibly damaging 0.85
R7450:Svep1 UTSW 4 58064248 missense possibly damaging 0.71
R7492:Svep1 UTSW 4 58066468 missense possibly damaging 0.51
R7505:Svep1 UTSW 4 58115862 missense possibly damaging 0.53
R7509:Svep1 UTSW 4 58090683 missense probably benign 0.40
R7538:Svep1 UTSW 4 58053260 missense possibly damaging 0.71
R7555:Svep1 UTSW 4 58069422 missense probably damaging 0.98
R7660:Svep1 UTSW 4 58087782 missense probably benign 0.32
R7670:Svep1 UTSW 4 58097424 missense probably damaging 1.00
R7719:Svep1 UTSW 4 58068523 missense probably damaging 0.97
R7733:Svep1 UTSW 4 58049239 missense probably benign 0.03
R7781:Svep1 UTSW 4 58069251 missense possibly damaging 0.71
R7821:Svep1 UTSW 4 58179601 missense probably damaging 0.99
X0063:Svep1 UTSW 4 58070468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTCACACGTTGGGTAAGG -3'
(R):5'- GGTTATAAGCTTCATGGAAACCC -3'

Sequencing Primer
(F):5'- TAAGGCTGGCTCCATATCGC -3'
(R):5'- GAAGATGCCTTCCCAATGGTTC -3'
Posted On2016-06-15