Incidental Mutation 'R0446:Gad1-ps'
ID 39392
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Name glutamate decarboxylase 1, pseudogene
Synonyms Gad-1ps
MMRRC Submission 038647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.208) question?
Stock # R0446 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 99279906-99281681 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) C to A at 99281383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,971,766 (GRCm39) T42A probably benign Het
Actr3b T A 5: 26,036,730 (GRCm39) I181K probably damaging Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
B3galt4 T C 17: 34,169,992 (GRCm39) E82G probably benign Het
Bag1 G A 4: 40,936,609 (GRCm39) T349I probably benign Het
Brip1 A T 11: 86,048,427 (GRCm39) L305Q probably damaging Het
Cdipt A G 7: 126,577,436 (GRCm39) T61A probably damaging Het
Cmya5 T A 13: 93,230,164 (GRCm39) R1641S probably benign Het
Cog7 T C 7: 121,536,295 (GRCm39) D515G probably benign Het
Cpsf4 T A 5: 145,114,054 (GRCm39) L171Q probably damaging Het
Cstpp1 G A 2: 91,135,109 (GRCm39) T20I possibly damaging Het
Cuzd1 A T 7: 130,918,009 (GRCm39) probably null Het
Dapk1 T A 13: 60,873,101 (GRCm39) probably null Het
Diaph1 A G 18: 37,986,643 (GRCm39) V1114A possibly damaging Het
Emx2 A T 19: 59,452,348 (GRCm39) K211* probably null Het
Fam170a T A 18: 50,413,699 (GRCm39) C55S possibly damaging Het
Fbxw26 A G 9: 109,572,788 (GRCm39) S119P probably benign Het
Fhip2a G A 19: 57,369,839 (GRCm39) D461N probably benign Het
Fryl G A 5: 73,254,760 (GRCm39) T894M possibly damaging Het
Gss T C 2: 155,409,665 (GRCm39) E257G probably benign Het
Klhdc1 A C 12: 69,330,082 (GRCm39) S404R probably benign Het
Kmt2e T A 5: 23,702,532 (GRCm39) probably null Het
Krt20 G A 11: 99,328,602 (GRCm39) Q108* probably null Het
Lmnb1 T A 18: 56,876,331 (GRCm39) S480T probably benign Het
Lyst T A 13: 13,812,633 (GRCm39) M1015K probably benign Het
Mdm1 T G 10: 117,987,961 (GRCm39) S290A probably benign Het
Mkln1 T A 6: 31,426,439 (GRCm39) F238I probably damaging Het
Mrgprb3 A G 7: 48,292,984 (GRCm39) V189A probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neurod6 C T 6: 55,656,614 (GRCm39) E8K probably benign Het
Nlrp12 T C 7: 3,282,659 (GRCm39) I747V probably benign Het
Notch4 C T 17: 34,784,337 (GRCm39) R43W possibly damaging Het
Obscn A T 11: 58,886,238 (GRCm39) probably benign Het
Or10d3 A T 9: 39,461,747 (GRCm39) I140N probably damaging Het
Or5p57 A T 7: 107,665,932 (GRCm39) Y24* probably null Het
Or5w20 T C 2: 87,727,199 (GRCm39) Y219H possibly damaging Het
Or6ae1 A T 7: 139,742,384 (GRCm39) S160T probably damaging Het
Or6z5 T C 7: 6,478,024 (GRCm39) V305A probably benign Het
Or8b53 G T 9: 38,667,114 (GRCm39) L43F probably damaging Het
Orc5 C T 5: 22,751,455 (GRCm39) V85I probably benign Het
Pccb T C 9: 100,864,850 (GRCm39) D468G probably damaging Het
Pdzd2 A T 15: 12,375,110 (GRCm39) V1675E probably benign Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Pltp A T 2: 164,696,320 (GRCm39) N97K probably damaging Het
Polr1a T C 6: 71,927,648 (GRCm39) probably null Het
Prss42 G A 9: 110,628,341 (GRCm39) V162I possibly damaging Het
Rbfox2 A T 15: 76,983,455 (GRCm39) Y269N probably damaging Het
Rftn2 A T 1: 55,253,354 (GRCm39) I83K probably damaging Het
S1pr4 A T 10: 81,334,823 (GRCm39) I217N probably damaging Het
Slc23a2 T C 2: 131,920,353 (GRCm39) K184R probably benign Het
Slc6a19 T C 13: 73,839,814 (GRCm39) N156S probably benign Het
Svep1 C T 4: 58,088,280 (GRCm39) G1723D probably damaging Het
Tbc1d32 T A 10: 56,068,994 (GRCm39) H358L possibly damaging Het
Tex55 G A 16: 38,649,064 (GRCm39) T15I probably benign Het
Tigit G T 16: 43,482,634 (GRCm39) N33K probably damaging Het
Tmem25 T C 9: 44,707,878 (GRCm39) Y139C probably damaging Het
Trmt13 G A 3: 116,376,275 (GRCm39) T372M probably damaging Het
Ubr2 A T 17: 47,294,224 (GRCm39) M303K probably damaging Het
Usp34 A G 11: 23,417,207 (GRCm39) E2952G probably damaging Het
Zan T A 5: 137,389,920 (GRCm39) I4851F unknown Het
Zfand4 C T 6: 116,265,015 (GRCm39) T160I probably benign Het
Zfp1005 A G 2: 150,109,993 (GRCm39) T228A possibly damaging Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99,281,310 (GRCm39) exon noncoding transcript
IGL01301:Gad1-ps APN 10 99,281,013 (GRCm39) exon noncoding transcript
IGL01394:Gad1-ps APN 10 99,281,424 (GRCm39) exon noncoding transcript
IGL02220:Gad1-ps APN 10 99,281,184 (GRCm39) exon noncoding transcript
IGL02240:Gad1-ps APN 10 99,280,820 (GRCm39) exon noncoding transcript
IGL03406:Gad1-ps APN 10 99,280,641 (GRCm39) exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99,281,013 (GRCm39) exon noncoding transcript
R0305:Gad1-ps UTSW 10 99,280,665 (GRCm39) exon noncoding transcript
R0538:Gad1-ps UTSW 10 99,280,854 (GRCm39) exon noncoding transcript
R1511:Gad1-ps UTSW 10 99,281,331 (GRCm39) exon noncoding transcript
R1734:Gad1-ps UTSW 10 99,281,637 (GRCm39) exon noncoding transcript
R1745:Gad1-ps UTSW 10 99,281,386 (GRCm39) exon noncoding transcript
R1886:Gad1-ps UTSW 10 99,281,444 (GRCm39) exon noncoding transcript
R3111:Gad1-ps UTSW 10 99,280,383 (GRCm39) exon noncoding transcript
R3617:Gad1-ps UTSW 10 99,281,260 (GRCm39) exon noncoding transcript
R5042:Gad1-ps UTSW 10 99,281,516 (GRCm39) exon noncoding transcript
R5223:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5234:Gad1-ps UTSW 10 99,281,188 (GRCm39) exon noncoding transcript
R5275:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5295:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5334:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5335:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5336:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5337:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5396:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5397:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5399:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5428:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5429:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5431:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5661:Gad1-ps UTSW 10 99,280,901 (GRCm39) exon noncoding transcript
R5667:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5671:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5885:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5886:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAGATAATGGGCGTACCGCTCCAG -3'
(R):5'- GGAAGAAGTTCACCTTGTCCCCTTG -3'

Sequencing Primer
(F):5'- TATGCTCCAAGGATGCAGC -3'
(R):5'- TTGAGGCTGGTAGCCCAC -3'
Posted On 2013-05-23