Mutagenetix > Incidental Mutations

Incidental Mutation 'R5112:Gtf2ird1'

393922

Institutional Source

Beutler Lab

Gene Symbol

Gtf2ird1

Ensembl Gene

ENSMUSG00000023079

Gene Name

general transcription factor II I repeat domain-containing 1

Synonyms

binding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN

MMRRC Submission

042700-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.653) question?

Stock #

R5112 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134357656-134456716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 134402184 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 339 (D339E)

Ref Sequence

ENSEMBL: ENSMUSP00000143809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202280] [ENSMUST00000202554]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073161
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	814	889	1.7e-34	PFAM
Pfam:GTF2I	917	992	1.7e-34	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000074114
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.5e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	2.8e-34	PFAM
Pfam:GTF2I	814	889	1.6e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100650
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.2e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	787	862	1.8e-34	PFAM
Pfam:GTF2I	890	965	1.8e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100652
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.8e-29	PFAM
Pfam:GTF2I	351	425	6.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.3e-34	PFAM
Pfam:GTF2I	690	764	3.3e-32	PFAM
Pfam:GTF2I	814	888	3e-33	PFAM
Pfam:GTF2I	917	991	3e-33	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100654
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	716	791	1.5e-34	PFAM
Pfam:GTF2I	819	894	1.5e-34	PFAM
low complexity region	922	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111244
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.3e-29	PFAM
Pfam:GTF2I	351	425	4.9e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1.7e-34	PFAM
Pfam:GTF2I	690	764	2.5e-32	PFAM
Pfam:GTF2I	787	861	2.3e-33	PFAM
Pfam:GTF2I	890	964	2.3e-33	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111245
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.6e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	671	746	2.9e-34	PFAM
Pfam:GTF2I	768	843	1.7e-34	PFAM
Pfam:GTF2I	871	946	1.7e-34	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167084
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	690	765	2.7e-34	PFAM
Pfam:GTF2I	814	889	1.5e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171794
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.2e-29	PFAM
Pfam:GTF2I	351	426	3.8e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	8.9e-35	PFAM
Pfam:GTF2I	690	765	2.4e-34	PFAM
Pfam:GTF2I	787	862	1.4e-34	PFAM
Pfam:GTF2I	890	965	1.4e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200944
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.9e-29	PFAM
Pfam:GTF2I	351	425	5.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2e-34	PFAM
Pfam:GTF2I	690	764	2.8e-32	PFAM
Pfam:GTF2I	814	888	2.6e-33	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000201704
AA Change: D126E

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202202

Predicted Effect

probably damaging
Transcript: ENSMUST00000202280
AA Change: D339E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	2.6e-26	PFAM
Pfam:GTF2I	351	425	2.9e-29	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1e-31	PFAM
Pfam:GTF2I	690	764	1.5e-29	PFAM
Pfam:GTF2I	787	861	1.3e-30	PFAM
low complexity region	890	913	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202335

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202414

Predicted Effect

probably damaging
Transcript: ENSMUST00000202554
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: D339E

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.5e-29	PFAM
Pfam:GTF2I	351	425	6.3e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.2e-34	PFAM
Pfam:GTF2I	671	745	3.2e-32	PFAM
Pfam:GTF2I	768	842	2.9e-33	PFAM
Pfam:GTF2I	871	945	2.9e-33	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202763

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,877,465	M80K	probably benign	Het
Abca2	A	G	2: 25,438,371	K846R	probably damaging	Het
Acsm5	A	G	7: 119,537,279	K358E	possibly damaging	Het
Adam26a	A	T	8: 43,568,856	D532E	probably benign	Het
Adamts19	C	T	18: 59,031,804	R993*	probably null	Het
Akr1c13	A	G	13: 4,194,152	K68R	possibly damaging	Het
Als2cr12	T	C	1: 58,659,282	T326A	probably benign	Het
Amer3	T	A	1: 34,587,076	M132K	possibly damaging	Het
Ankrd2	A	G	19: 42,039,887	D38G	possibly damaging	Het
Ano7	G	A	1: 93,397,363	V546M	possibly damaging	Het
Aox2	G	A	1: 58,310,095		probably null	Het
Apc	T	A	18: 34,316,109	C1985*	probably null	Het
Astn1	C	T	1: 158,657,193	S15F	possibly damaging	Het
Atp13a4	A	T	16: 29,409,868	N950K	possibly damaging	Het
Bcl6	A	G	16: 23,972,746	V286A	probably benign	Het
Brox	T	A	1: 183,291,977	T79S	probably benign	Het
C2cd3	A	T	7: 100,443,485	I512F	possibly damaging	Het
Camta1	A	G	4: 151,074,054	L542S	probably damaging	Het
Capn13	GCA	G	17: 73,351,506		probably null	Het
Card10	C	T	15: 78,802,380		probably null	Het
Cd96	A	G	16: 46,098,938	M240T	probably benign	Het
Cdc123	A	G	2: 5,804,937	L221P	possibly damaging	Het
Cdh19	A	G	1: 110,954,624	V46A	possibly damaging	Het
Clcn3	G	A	8: 60,954,552	H24Y	probably benign	Het
Col11a2	T	C	17: 34,064,088		probably benign	Het
Cpsf3	A	T	12: 21,291,784	M50L	probably benign	Het
Csf3	T	A	11: 98,702,923	L197Q	probably damaging	Het
Ctsw	T	A	19: 5,466,257	D196V	probably damaging	Het
Dcun1d3	A	T	7: 119,858,027	I154K	probably damaging	Het
Ddr1	T	C	17: 35,682,485	T877A	probably benign	Het
Dnah8	T	A	17: 30,731,038	L1944I	probably benign	Het
Dpf3	G	T	12: 83,370,611	S29*	probably null	Het
Ephb1	A	G	9: 101,971,179	I640T	probably damaging	Het
Fat1	G	A	8: 45,024,282	G2099S	probably damaging	Het
Fbxo41	G	T	6: 85,477,924	N667K	probably damaging	Het
Gart	A	T	16: 91,634,045	D376E	probably benign	Het
Glyr1	G	A	16: 5,018,876	Q475*	probably null	Het
Gm28051	G	A	12: 102,720,171	Q77*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gnmt	C	A	17: 46,726,330	R176L	probably damaging	Het
Gpr176	A	T	2: 118,280,148	V210D	possibly damaging	Het
Hmbox1	A	G	14: 64,825,612	Y372H	probably damaging	Het
Ier2	G	T	8: 84,662,732	A7E	probably damaging	Het
Il20ra	A	G	10: 19,758,943	T311A	possibly damaging	Het
Il24	T	C	1: 130,883,442		probably null	Het
Insl6	G	A	19: 29,321,596	Q139*	probably null	Het
Itga2b	A	T	11: 102,458,191	I729K	probably damaging	Het
Itpr2	A	T	6: 146,233,991	M1814K	possibly damaging	Het
Klhl3	G	A	13: 58,018,889	S429F	probably damaging	Het
Lipo2	T	C	19: 33,748,465	N129S	probably benign	Het
Lrba	C	T	3: 86,225,371	T28M	probably benign	Het
Ly86	G	T	13: 37,375,037	G71C	probably damaging	Het
Maob	T	C	X: 16,716,423	T400A	probably benign	Het
Mical2	A	G	7: 112,320,611	S443G	probably damaging	Het
Mmp17	A	G	5: 129,602,165	H376R	possibly damaging	Het
Myo7b	T	C	18: 31,983,587	H989R	probably damaging	Het
Neil2	A	G	14: 63,188,460	W154R	probably damaging	Het
Nlrp12	G	A	7: 3,240,983	H300Y	possibly damaging	Het
Nlrp3	A	T	11: 59,548,728	Y377F	probably damaging	Het
Notch2	T	C	3: 98,101,636		probably null	Het
Nudcd1	A	T	15: 44,376,643	C500*	probably null	Het
Olfr1099	A	T	2: 86,959,354	Y35N	probably damaging	Het
Olfr1164	A	G	2: 88,093,009	V309A	probably damaging	Het
Olfr1449	T	C	19: 12,934,816	V26A	probably benign	Het
Olfr1537	A	G	9: 39,238,421	M1T	probably null	Het
Pabpc6	T	A	17: 9,669,611	S4C	probably damaging	Het
Pan2	C	T	10: 128,315,595	R835*	probably null	Het
Parp9	G	A	16: 35,964,313	V346I	probably damaging	Het
Pcbp4	C	T	9: 106,460,718	T69M	probably damaging	Het
Pclo	T	A	5: 14,677,882		probably benign	Het
Phldb3	A	T	7: 24,624,685	I495F	possibly damaging	Het
Plce1	G	T	19: 38,651,833	V508F	probably benign	Het
Pmpca	A	T	2: 26,395,166	I468F	probably damaging	Het
Pmpcb	G	A	5: 21,756,443	R399H	probably damaging	Het
Ptprc	A	G	1: 138,094,299	S544P	probably damaging	Het
Rev3l	T	A	10: 39,823,330	D1274E	probably benign	Het
Ryr3	A	T	2: 112,902,665	V612E	probably damaging	Het
Scfd2	G	T	5: 74,206,321	H639Q	probably benign	Het
Sell	T	A	1: 164,065,318	H34Q	possibly damaging	Het
Setd2	A	G	9: 110,548,158	D347G	probably benign	Het
Sgip1	G	A	4: 102,869,769	D81N	probably damaging	Het
Slc12a1	A	T	2: 125,218,224	I940F	possibly damaging	Het
Slc25a34	T	A	4: 141,621,458	I232L	probably benign	Het
Slc36a3	T	A	11: 55,148,573	K76N	probably damaging	Het
Slc6a15	T	A	10: 103,389,226	D58E	probably benign	Het
Slc6a7	T	C	18: 61,007,376	S195G	probably null	Het
Svep1	G	A	4: 58,068,610	Q3059*	probably null	Het
Syce1l	A	C	8: 113,651,642	H56P	probably damaging	Het
Tbc1d2	A	G	4: 46,606,503	V814A	probably damaging	Het
Tbx18	T	A	9: 87,715,687	I265F	probably damaging	Het
Thbs2	T	C	17: 14,670,590		probably null	Het
Ttll1	T	C	15: 83,496,396	H256R	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttyh2	A	T	11: 114,696,757	T195S	probably benign	Het
Unc119b	A	G	5: 115,125,494	L217P	probably damaging	Het
Unc5a	T	C	13: 55,003,418		probably null	Het
Usp6nl	A	G	2: 6,420,903	K152E	probably benign	Het
Vcam1	T	C	3: 116,117,292	R486G	probably benign	Het
Vmn2r1	A	C	3: 64,090,123	Q400P	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,458	V706D	possibly damaging	Het
Vmn2r87	A	T	10: 130,478,553	L388Q	probably damaging	Het
Vwa3a	A	T	7: 120,783,985	Y603F	probably damaging	Het
Zfp850	A	T	7: 27,990,233	C183*	probably null	Het

Other mutations in Gtf2ird1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Gtf2ird1	APN	5	134358891	missense	probably benign	0.03
IGL02477:Gtf2ird1	APN	5	134379978	missense	probably damaging	1.00
IGL02659:Gtf2ird1	APN	5	134377041	missense	probably damaging	1.00
IGL02752:Gtf2ird1	APN	5	134358824	makesense	probably null
IGL02963:Gtf2ird1	APN	5	134389687	missense	probably benign	0.05
IGL03328:Gtf2ird1	APN	5	134389129	critical splice donor site	probably null
IGL03379:Gtf2ird1	APN	5	134382538	missense	possibly damaging	0.94
R0585:Gtf2ird1	UTSW	5	134376942	missense	probably damaging	1.00
R1199:Gtf2ird1	UTSW	5	134411064	missense	possibly damaging	0.85
R1388:Gtf2ird1	UTSW	5	134395710	missense	probably damaging	1.00
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1544:Gtf2ird1	UTSW	5	134358918	missense	possibly damaging	0.93
R1652:Gtf2ird1	UTSW	5	134395713	missense	probably damaging	1.00
R1792:Gtf2ird1	UTSW	5	134366936	intron	probably null
R1852:Gtf2ird1	UTSW	5	134382580	unclassified	probably null
R1938:Gtf2ird1	UTSW	5	134415245	missense	probably damaging	1.00
R1996:Gtf2ird1	UTSW	5	134376886	splice site	probably benign
R2020:Gtf2ird1	UTSW	5	134417093	missense	probably damaging	1.00
R2025:Gtf2ird1	UTSW	5	134363934	missense	probably damaging	1.00
R2849:Gtf2ird1	UTSW	5	134359007	missense	probably damaging	1.00
R2964:Gtf2ird1	UTSW	5	134357684	unclassified	probably null
R3421:Gtf2ird1	UTSW	5	134388500	missense	probably benign	0.41
R4543:Gtf2ird1	UTSW	5	134363900	critical splice donor site	probably null
R4569:Gtf2ird1	UTSW	5	134411003	missense	probably damaging	1.00
R4664:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4665:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4666:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4680:Gtf2ird1	UTSW	5	134357881	missense	probably damaging	1.00
R4709:Gtf2ird1	UTSW	5	134404734	missense	probably benign
R4806:Gtf2ird1	UTSW	5	134383896	missense	probably damaging	0.99
R4823:Gtf2ird1	UTSW	5	134395722	missense	probably damaging	1.00
R4857:Gtf2ird1	UTSW	5	134362544	missense	probably damaging	0.96
R4970:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R4974:Gtf2ird1	UTSW	5	134357831	nonsense	probably null
R4975:Gtf2ird1	UTSW	5	134395627	missense	probably damaging	1.00
R5072:Gtf2ird1	UTSW	5	134390933	splice site	probably null
R5653:Gtf2ird1	UTSW	5	134410967	missense	probably damaging	1.00
R5681:Gtf2ird1	UTSW	5	134363318	missense	probably damaging	1.00
R5738:Gtf2ird1	UTSW	5	134383818	missense	probably damaging	1.00
R5753:Gtf2ird1	UTSW	5	134410983	missense	probably damaging	1.00
R6385:Gtf2ird1	UTSW	5	134404690	missense	probably benign	0.19
R6580:Gtf2ird1	UTSW	5	134361039	missense	probably damaging	1.00
R6787:Gtf2ird1	UTSW	5	134363912	missense	probably damaging	0.99
R6981:Gtf2ird1	UTSW	5	134383922	splice site	probably benign
R7208:Gtf2ird1	UTSW	5	134411094	missense	probably benign	0.35
R7271:Gtf2ird1	UTSW	5	134404904	missense	probably benign	0.01
R7517:Gtf2ird1	UTSW	5	134362525	missense	probably benign
R7788:Gtf2ird1	UTSW	5	134417131	nonsense	probably null
X0026:Gtf2ird1	UTSW	5	134376102	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- CCACAAAGAATCTGCGAAGG -3'
(R):5'- ATCTCAAAGGGGCTGAGGTG -3'

Sequencing Primer
(F):5'- TCTGCGAAGGAAATATTGACACAAC -3'
(R):5'- GACTGTGAGTGGGAGGCC -3'

Posted On

2016-06-15