Incidental Mutation 'R0446:Mdm1'
Institutional Source Beutler Lab
Gene Symbol Mdm1
Ensembl Gene ENSMUSG00000020212
Gene Nametransformed mouse 3T3 cell double minute 1
SynonymsArrd2, Mdm-1
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosomal Location118141811-118168997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 118152056 bp
Amino Acid Change Serine to Alanine at position 290 (S290A)
Ref Sequence ENSEMBL: ENSMUSP00000132966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020437] [ENSMUST00000163238] [ENSMUST00000164077] [ENSMUST00000169817] [ENSMUST00000219087]
Predicted Effect probably benign
Transcript: ENSMUST00000020437
AA Change: S290A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020437
Gene: ENSMUSG00000020212
AA Change: S290A

Pfam:MDM1 9 544 1.1e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163238
AA Change: S290A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127919
Gene: ENSMUSG00000020212
AA Change: S290A

Pfam:MDM1 9 554 1.3e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164077
AA Change: S290A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132966
Gene: ENSMUSG00000020212
AA Change: S290A

Pfam:MDM1 9 544 5.5e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169817
AA Change: S245A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126258
Gene: ENSMUSG00000020212
AA Change: S245A

Pfam:MDM1 9 172 8.3e-55 PFAM
Pfam:MDM1 168 509 1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218400
Predicted Effect probably benign
Transcript: ENSMUST00000219087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219605
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein similar to the mouse double minute 1 protein. The mouse gene is located in double minute (DM) chromatin particles, is amplified in the mouse transformed 3T3 cell line, and the encoded protein is able to bind to p53. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a nonsense point mutation exhibit retinal degeneration, abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Mdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Mdm1 APN 10 118164441 missense probably damaging 1.00
IGL01400:Mdm1 APN 10 118157251 missense probably damaging 1.00
IGL01504:Mdm1 APN 10 118146600 missense probably damaging 1.00
IGL02070:Mdm1 APN 10 118146618 missense probably damaging 1.00
IGL02149:Mdm1 APN 10 118148065 missense probably damaging 1.00
IGL02817:Mdm1 APN 10 118164346 missense possibly damaging 0.66
IGL03076:Mdm1 APN 10 118159683 missense possibly damaging 0.95
PIT4696001:Mdm1 UTSW 10 118158540 missense probably benign
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0166:Mdm1 UTSW 10 118166680 missense probably damaging 0.96
R0218:Mdm1 UTSW 10 118156878 splice site probably benign
R0605:Mdm1 UTSW 10 118146601 missense probably damaging 1.00
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R2873:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R4816:Mdm1 UTSW 10 118146877 missense possibly damaging 0.82
R5571:Mdm1 UTSW 10 118159683 missense possibly damaging 0.95
R5623:Mdm1 UTSW 10 118150789 missense possibly damaging 0.66
R5806:Mdm1 UTSW 10 118166658 missense probably benign
R6537:Mdm1 UTSW 10 118158576 missense probably benign 0.00
R6539:Mdm1 UTSW 10 118150958 critical splice donor site probably null
R6891:Mdm1 UTSW 10 118148032 missense probably benign 0.04
R6952:Mdm1 UTSW 10 118168057 missense probably damaging 1.00
R7176:Mdm1 UTSW 10 118142865 missense probably damaging 1.00
R7346:Mdm1 UTSW 10 118164288 nonsense probably null
R7442:Mdm1 UTSW 10 118146685 missense probably benign 0.16
R7464:Mdm1 UTSW 10 118152266 missense probably benign 0.00
Z1088:Mdm1 UTSW 10 118158362 missense possibly damaging 0.67
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttgtttgtttgtttgtttgtttgc -3'
Posted On2013-05-23