Incidental Mutation 'R5112:Pcbp4'
ID393942
Institutional Source Beutler Lab
Gene Symbol Pcbp4
Ensembl Gene ENSMUSG00000023495
Gene Namepoly(rC) binding protein 4
Synonyms1200003L19Rik, AlphaCP-4
MMRRC Submission 042700-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R5112 (G1)
Quality Score150
Status Not validated
Chromosome9
Chromosomal Location106453291-106464012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106460718 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 69 (T69M)
Ref Sequence ENSEMBL: ENSMUSP00000024260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024260] [ENSMUST00000164834] [ENSMUST00000185507] [ENSMUST00000185779] [ENSMUST00000185874] [ENSMUST00000188396] [ENSMUST00000189099] [ENSMUST00000190428] [ENSMUST00000190430] [ENSMUST00000213156] [ENSMUST00000214252] [ENSMUST00000215656] [ENSMUST00000216379]
Predicted Effect probably damaging
Transcript: ENSMUST00000024260
AA Change: T69M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024260
Gene: ENSMUSG00000023495
AA Change: T69M

DomainStartEndE-ValueType
KH 16 84 4.15e-14 SMART
KH 100 171 1.47e-14 SMART
KH 240 310 3.24e-16 SMART
low complexity region 327 349 N/A INTRINSIC
low complexity region 364 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164834
SMART Domains Protein: ENSMUSP00000129055
Gene: ENSMUSG00000091735

DomainStartEndE-ValueType
Pfam:7tm_1 31 286 1.1e-16 PFAM
low complexity region 294 311 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185507
SMART Domains Protein: ENSMUSP00000140660
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 2 65 2.4e-10 SMART
low complexity region 117 131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185779
AA Change: T69M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140629
Gene: ENSMUSG00000023495
AA Change: T69M

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
KH 100 171 9.3e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185854
Predicted Effect probably damaging
Transcript: ENSMUST00000185874
AA Change: T69M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141057
Gene: ENSMUSG00000023495
AA Change: T69M

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186519
Predicted Effect probably benign
Transcript: ENSMUST00000188396
SMART Domains Protein: ENSMUSP00000139771
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
Blast:KH 1 41 2e-19 BLAST
KH 61 122 1.7e-7 SMART
low complexity region 139 161 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188448
Predicted Effect probably damaging
Transcript: ENSMUST00000189099
AA Change: T20M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139991
Gene: ENSMUSG00000023495
AA Change: T20M

DomainStartEndE-ValueType
Pfam:KH_1 33 77 1.3e-9 PFAM
Pfam:KH_3 36 77 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189882
Predicted Effect probably benign
Transcript: ENSMUST00000190428
SMART Domains Protein: ENSMUSP00000139587
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
PDB:2JZX|A 1 33 1e-8 PDB
Blast:KH 30 80 3e-26 BLAST
KH 100 167 2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190430
AA Change: T69M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140485
Gene: ENSMUSG00000023495
AA Change: T69M

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190799
Predicted Effect probably benign
Transcript: ENSMUST00000213156
Predicted Effect probably benign
Transcript: ENSMUST00000213201
Predicted Effect probably benign
Transcript: ENSMUST00000213752
Predicted Effect probably damaging
Transcript: ENSMUST00000214252
AA Change: T69M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000215656
Predicted Effect probably damaging
Transcript: ENSMUST00000216379
AA Change: T69M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217405
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. This gene is induced by the p53 tumor suppressor, and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle arrest in G(2)-M. This gene's protein is found in the cytoplasm, yet it lacks the nuclear localization signals found in other subfamily members. Multiple alternatively spliced transcript variants have been described, but the full-length nature for only some has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele are reduced in body weight and prone to lung adenocarcinoma, B cell derived lymphoma and lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,877,465 M80K probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acsm5 A G 7: 119,537,279 K358E possibly damaging Het
Adam26a A T 8: 43,568,856 D532E probably benign Het
Adamts19 C T 18: 59,031,804 R993* probably null Het
Akr1c13 A G 13: 4,194,152 K68R possibly damaging Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Amer3 T A 1: 34,587,076 M132K possibly damaging Het
Ankrd2 A G 19: 42,039,887 D38G possibly damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Apc T A 18: 34,316,109 C1985* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Atp13a4 A T 16: 29,409,868 N950K possibly damaging Het
Bcl6 A G 16: 23,972,746 V286A probably benign Het
Brox T A 1: 183,291,977 T79S probably benign Het
C2cd3 A T 7: 100,443,485 I512F possibly damaging Het
Camta1 A G 4: 151,074,054 L542S probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Cd96 A G 16: 46,098,938 M240T probably benign Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Clcn3 G A 8: 60,954,552 H24Y probably benign Het
Col11a2 T C 17: 34,064,088 probably benign Het
Cpsf3 A T 12: 21,291,784 M50L probably benign Het
Csf3 T A 11: 98,702,923 L197Q probably damaging Het
Ctsw T A 19: 5,466,257 D196V probably damaging Het
Dcun1d3 A T 7: 119,858,027 I154K probably damaging Het
Ddr1 T C 17: 35,682,485 T877A probably benign Het
Dnah8 T A 17: 30,731,038 L1944I probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Ephb1 A G 9: 101,971,179 I640T probably damaging Het
Fat1 G A 8: 45,024,282 G2099S probably damaging Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gart A T 16: 91,634,045 D376E probably benign Het
Glyr1 G A 16: 5,018,876 Q475* probably null Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnmt C A 17: 46,726,330 R176L probably damaging Het
Gpr176 A T 2: 118,280,148 V210D possibly damaging Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Hmbox1 A G 14: 64,825,612 Y372H probably damaging Het
Ier2 G T 8: 84,662,732 A7E probably damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Insl6 G A 19: 29,321,596 Q139* probably null Het
Itga2b A T 11: 102,458,191 I729K probably damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Klhl3 G A 13: 58,018,889 S429F probably damaging Het
Lipo2 T C 19: 33,748,465 N129S probably benign Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Ly86 G T 13: 37,375,037 G71C probably damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Mical2 A G 7: 112,320,611 S443G probably damaging Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Myo7b T C 18: 31,983,587 H989R probably damaging Het
Neil2 A G 14: 63,188,460 W154R probably damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr1449 T C 19: 12,934,816 V26A probably benign Het
Olfr1537 A G 9: 39,238,421 M1T probably null Het
Pabpc6 T A 17: 9,669,611 S4C probably damaging Het
Pan2 C T 10: 128,315,595 R835* probably null Het
Parp9 G A 16: 35,964,313 V346I probably damaging Het
Pclo T A 5: 14,677,882 probably benign Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Plce1 G T 19: 38,651,833 V508F probably benign Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Ryr3 A T 2: 112,902,665 V612E probably damaging Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sgip1 G A 4: 102,869,769 D81N probably damaging Het
Slc12a1 A T 2: 125,218,224 I940F possibly damaging Het
Slc25a34 T A 4: 141,621,458 I232L probably benign Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a15 T A 10: 103,389,226 D58E probably benign Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Svep1 G A 4: 58,068,610 Q3059* probably null Het
Syce1l A C 8: 113,651,642 H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 V814A probably damaging Het
Tbx18 T A 9: 87,715,687 I265F probably damaging Het
Thbs2 T C 17: 14,670,590 probably null Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Unc5a T C 13: 55,003,418 probably null Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r80 T A 10: 79,194,458 V706D possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Vwa3a A T 7: 120,783,985 Y603F probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Pcbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Pcbp4 APN 9 106463249 unclassified probably null
IGL01484:Pcbp4 APN 9 106460649 critical splice acceptor site probably null
R1688:Pcbp4 UTSW 9 106461334 missense probably damaging 1.00
R2211:Pcbp4 UTSW 9 106460734 missense probably benign 0.28
R3894:Pcbp4 UTSW 9 106461371 missense possibly damaging 0.82
R4729:Pcbp4 UTSW 9 106460730 missense probably damaging 1.00
R4884:Pcbp4 UTSW 9 106462102 missense probably benign 0.03
R5007:Pcbp4 UTSW 9 106462093 missense probably damaging 1.00
R6050:Pcbp4 UTSW 9 106462223 missense probably benign 0.41
R6747:Pcbp4 UTSW 9 106460648 splice site probably null
X0027:Pcbp4 UTSW 9 106462583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGAAGAATGGCAGTTTC -3'
(R):5'- TCCCTCAAGAACTTTCCTGAAG -3'

Sequencing Primer
(F):5'- CCCAGAAGAATGGCAGTTTCTAGTC -3'
(R):5'- CTCAAGAACTTTCCTGAAGAGGGAG -3'
Posted On2016-06-15