Mutagenetix > Incidental Mutation

Incidental Mutation 'R5112:Il20ra'

393944

Institutional Source

Beutler Lab

Gene Symbol

Il20ra

Ensembl Gene

ENSMUSG00000020007

Gene Name

interleukin 20 receptor, alpha

Synonyms

MMRRC Submission

042700-MU

Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5112 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19712570-19760053 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19758943 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 311 (T311A)

Ref Sequence

ENSEMBL: ENSMUSP00000020185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]

AlphaFold

Q6PHB0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020185
AA Change: T311A

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: T311A

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	16	126	1.8e-33	PFAM
Pfam:Interfer-bind	138	243	4.6e-23	PFAM
transmembrane domain	255	277	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217389

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,877,465	M80K	probably benign	Het
Abca2	A	G	2: 25,438,371	K846R	probably damaging	Het
Acsm5	A	G	7: 119,537,279	K358E	possibly damaging	Het
Adam26a	A	T	8: 43,568,856	D532E	probably benign	Het
Adamts19	C	T	18: 59,031,804	R993*	probably null	Het
Akr1c13	A	G	13: 4,194,152	K68R	possibly damaging	Het
Als2cr12	T	C	1: 58,659,282	T326A	probably benign	Het
Amer3	T	A	1: 34,587,076	M132K	possibly damaging	Het
Ankrd2	A	G	19: 42,039,887	D38G	possibly damaging	Het
Ano7	G	A	1: 93,397,363	V546M	possibly damaging	Het
Aox2	G	A	1: 58,310,095		probably null	Het
Apc	T	A	18: 34,316,109	C1985*	probably null	Het
Astn1	C	T	1: 158,657,193	S15F	possibly damaging	Het
Atp13a4	A	T	16: 29,409,868	N950K	possibly damaging	Het
Bcl6	A	G	16: 23,972,746	V286A	probably benign	Het
Brox	T	A	1: 183,291,977	T79S	probably benign	Het
C2cd3	A	T	7: 100,443,485	I512F	possibly damaging	Het
Camta1	A	G	4: 151,074,054	L542S	probably damaging	Het
Capn13	GCA	G	17: 73,351,506		probably null	Het
Card10	C	T	15: 78,802,380		probably null	Het
Cd96	A	G	16: 46,098,938	M240T	probably benign	Het
Cdc123	A	G	2: 5,804,937	L221P	possibly damaging	Het
Cdh19	A	G	1: 110,954,624	V46A	possibly damaging	Het
Clcn3	G	A	8: 60,954,552	H24Y	probably benign	Het
Col11a2	T	C	17: 34,064,088		probably benign	Het
Cpsf3	A	T	12: 21,291,784	M50L	probably benign	Het
Csf3	T	A	11: 98,702,923	L197Q	probably damaging	Het
Ctsw	T	A	19: 5,466,257	D196V	probably damaging	Het
Dcun1d3	A	T	7: 119,858,027	I154K	probably damaging	Het
Ddr1	T	C	17: 35,682,485	T877A	probably benign	Het
Dnah8	T	A	17: 30,731,038	L1944I	probably benign	Het
Dpf3	G	T	12: 83,370,611	S29*	probably null	Het
Ephb1	A	G	9: 101,971,179	I640T	probably damaging	Het
Fat1	G	A	8: 45,024,282	G2099S	probably damaging	Het
Fbxo41	G	T	6: 85,477,924	N667K	probably damaging	Het
Gart	A	T	16: 91,634,045	D376E	probably benign	Het
Glyr1	G	A	16: 5,018,876	Q475*	probably null	Het
Gm28051	G	A	12: 102,720,171	Q77*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gnmt	C	A	17: 46,726,330	R176L	probably damaging	Het
Gpr176	A	T	2: 118,280,148	V210D	possibly damaging	Het
Gtf2ird1	A	T	5: 134,402,184	D339E	probably damaging	Het
Hmbox1	A	G	14: 64,825,612	Y372H	probably damaging	Het
Ier2	G	T	8: 84,662,732	A7E	probably damaging	Het
Il24	T	C	1: 130,883,442		probably null	Het
Insl6	G	A	19: 29,321,596	Q139*	probably null	Het
Itga2b	A	T	11: 102,458,191	I729K	probably damaging	Het
Itpr2	A	T	6: 146,233,991	M1814K	possibly damaging	Het
Klhl3	G	A	13: 58,018,889	S429F	probably damaging	Het
Lipo2	T	C	19: 33,748,465	N129S	probably benign	Het
Lrba	C	T	3: 86,225,371	T28M	probably benign	Het
Ly86	G	T	13: 37,375,037	G71C	probably damaging	Het
Maob	T	C	X: 16,716,423	T400A	probably benign	Het
Mical2	A	G	7: 112,320,611	S443G	probably damaging	Het
Mmp17	A	G	5: 129,602,165	H376R	possibly damaging	Het
Myo7b	T	C	18: 31,983,587	H989R	probably damaging	Het
Neil2	A	G	14: 63,188,460	W154R	probably damaging	Het
Nlrp12	G	A	7: 3,240,983	H300Y	possibly damaging	Het
Nlrp3	A	T	11: 59,548,728	Y377F	probably damaging	Het
Notch2	T	C	3: 98,101,636		probably null	Het
Nudcd1	A	T	15: 44,376,643	C500*	probably null	Het
Olfr1099	A	T	2: 86,959,354	Y35N	probably damaging	Het
Olfr1164	A	G	2: 88,093,009	V309A	probably damaging	Het
Olfr1449	T	C	19: 12,934,816	V26A	probably benign	Het
Olfr1537	A	G	9: 39,238,421	M1T	probably null	Het
Pabpc6	T	A	17: 9,669,611	S4C	probably damaging	Het
Pan2	C	T	10: 128,315,595	R835*	probably null	Het
Parp9	G	A	16: 35,964,313	V346I	probably damaging	Het
Pcbp4	C	T	9: 106,460,718	T69M	probably damaging	Het
Pclo	T	A	5: 14,677,882		probably benign	Het
Phldb3	A	T	7: 24,624,685	I495F	possibly damaging	Het
Plce1	G	T	19: 38,651,833	V508F	probably benign	Het
Pmpca	A	T	2: 26,395,166	I468F	probably damaging	Het
Pmpcb	G	A	5: 21,756,443	R399H	probably damaging	Het
Ptprc	A	G	1: 138,094,299	S544P	probably damaging	Het
Rev3l	T	A	10: 39,823,330	D1274E	probably benign	Het
Ryr3	A	T	2: 112,902,665	V612E	probably damaging	Het
Scfd2	G	T	5: 74,206,321	H639Q	probably benign	Het
Sell	T	A	1: 164,065,318	H34Q	possibly damaging	Het
Setd2	A	G	9: 110,548,158	D347G	probably benign	Het
Sgip1	G	A	4: 102,869,769	D81N	probably damaging	Het
Slc12a1	A	T	2: 125,218,224	I940F	possibly damaging	Het
Slc25a34	T	A	4: 141,621,458	I232L	probably benign	Het
Slc36a3	T	A	11: 55,148,573	K76N	probably damaging	Het
Slc6a15	T	A	10: 103,389,226	D58E	probably benign	Het
Slc6a7	T	C	18: 61,007,376	S195G	probably null	Het
Svep1	G	A	4: 58,068,610	Q3059*	probably null	Het
Syce1l	A	C	8: 113,651,642	H56P	probably damaging	Het
Tbc1d2	A	G	4: 46,606,503	V814A	probably damaging	Het
Tbx18	T	A	9: 87,715,687	I265F	probably damaging	Het
Thbs2	T	C	17: 14,670,590		probably null	Het
Ttll1	T	C	15: 83,496,396	H256R	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttyh2	A	T	11: 114,696,757	T195S	probably benign	Het
Unc119b	A	G	5: 115,125,494	L217P	probably damaging	Het
Unc5a	T	C	13: 55,003,418		probably null	Het
Usp6nl	A	G	2: 6,420,903	K152E	probably benign	Het
Vcam1	T	C	3: 116,117,292	R486G	probably benign	Het
Vmn2r1	A	C	3: 64,090,123	Q400P	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,458	V706D	possibly damaging	Het
Vmn2r87	A	T	10: 130,478,553	L388Q	probably damaging	Het
Vwa3a	A	T	7: 120,783,985	Y603F	probably damaging	Het
Zfp850	A	T	7: 27,990,233	C183*	probably null	Het

Other mutations in Il20ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01929:Il20ra	APN	10	19759271	missense	probably benign	0.01
IGL01936:Il20ra	APN	10	19755843	missense	probably damaging	1.00
IGL01958:Il20ra	APN	10	19759043	missense	probably benign	0.39
IGL02109:Il20ra	APN	10	19759505	missense	possibly damaging	0.80
IGL02207:Il20ra	APN	10	19751578	missense	probably damaging	0.99
IGL02234:Il20ra	APN	10	19749270	missense	probably damaging	1.00
IGL02959:Il20ra	APN	10	19759041	missense	probably benign	0.10
IGL03010:Il20ra	APN	10	19749212	missense	probably damaging	1.00
P0017:Il20ra	UTSW	10	19759406	missense	probably damaging	1.00
R0518:Il20ra	UTSW	10	19759640	missense	probably damaging	1.00
R0521:Il20ra	UTSW	10	19759640	missense	probably damaging	1.00
R1436:Il20ra	UTSW	10	19749252	missense	probably damaging	1.00
R1714:Il20ra	UTSW	10	19755828	missense	probably damaging	0.98
R1792:Il20ra	UTSW	10	19759636	missense	probably damaging	0.99
R1852:Il20ra	UTSW	10	19743019	missense	probably damaging	1.00
R2097:Il20ra	UTSW	10	19759463	missense	probably damaging	1.00
R4559:Il20ra	UTSW	10	19749284	missense	probably damaging	0.99
R4970:Il20ra	UTSW	10	19758943	missense	possibly damaging	0.61
R5267:Il20ra	UTSW	10	19749359	missense	probably damaging	0.99
R6543:Il20ra	UTSW	10	19749323	missense	probably damaging	1.00
R6755:Il20ra	UTSW	10	19750794	missense	probably benign	0.15
R6845:Il20ra	UTSW	10	19759311	missense	probably benign	0.06
R7014:Il20ra	UTSW	10	19712710	missense	unknown
R7190:Il20ra	UTSW	10	19742941	missense	probably damaging	0.99
R8134:Il20ra	UTSW	10	19750704	missense	probably damaging	0.99
R8955:Il20ra	UTSW	10	19759412	missense	possibly damaging	0.57
R9104:Il20ra	UTSW	10	19759616	missense	probably benign	0.21
R9439:Il20ra	UTSW	10	19743003	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTCTCTACGTGCCAAACATAACC -3'
(R):5'- CTTTGCTCAGCACCACAGAC -3'

Sequencing Primer
(F):5'- ACATAACCCCATCACTGGATG -3'
(R):5'- GCGTCCATCAAATGCGAAG -3'

Posted On

2016-06-15