Mutagenetix > Incidental Mutation

Incidental Mutation 'R5112:Slc6a15'

393947

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

042700-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5112 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103389226 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 58 (D58E)

Ref Sequence

ENSEMBL: ENSMUSP00000151517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]

AlphaFold

Q8BG16

Predicted Effect

probably benign
Transcript: ENSMUST00000074204
AA Change: D58E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: D58E

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179636
AA Change: D58E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: D58E

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217905
AA Change: D58E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219936

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,877,465	M80K	probably benign	Het
Abca2	A	G	2: 25,438,371	K846R	probably damaging	Het
Acsm5	A	G	7: 119,537,279	K358E	possibly damaging	Het
Adam26a	A	T	8: 43,568,856	D532E	probably benign	Het
Adamts19	C	T	18: 59,031,804	R993*	probably null	Het
Akr1c13	A	G	13: 4,194,152	K68R	possibly damaging	Het
Als2cr12	T	C	1: 58,659,282	T326A	probably benign	Het
Amer3	T	A	1: 34,587,076	M132K	possibly damaging	Het
Ankrd2	A	G	19: 42,039,887	D38G	possibly damaging	Het
Ano7	G	A	1: 93,397,363	V546M	possibly damaging	Het
Aox2	G	A	1: 58,310,095		probably null	Het
Apc	T	A	18: 34,316,109	C1985*	probably null	Het
Astn1	C	T	1: 158,657,193	S15F	possibly damaging	Het
Atp13a4	A	T	16: 29,409,868	N950K	possibly damaging	Het
Bcl6	A	G	16: 23,972,746	V286A	probably benign	Het
Brox	T	A	1: 183,291,977	T79S	probably benign	Het
C2cd3	A	T	7: 100,443,485	I512F	possibly damaging	Het
Camta1	A	G	4: 151,074,054	L542S	probably damaging	Het
Capn13	GCA	G	17: 73,351,506		probably null	Het
Card10	C	T	15: 78,802,380		probably null	Het
Cd96	A	G	16: 46,098,938	M240T	probably benign	Het
Cdc123	A	G	2: 5,804,937	L221P	possibly damaging	Het
Cdh19	A	G	1: 110,954,624	V46A	possibly damaging	Het
Clcn3	G	A	8: 60,954,552	H24Y	probably benign	Het
Col11a2	T	C	17: 34,064,088		probably benign	Het
Cpsf3	A	T	12: 21,291,784	M50L	probably benign	Het
Csf3	T	A	11: 98,702,923	L197Q	probably damaging	Het
Ctsw	T	A	19: 5,466,257	D196V	probably damaging	Het
Dcun1d3	A	T	7: 119,858,027	I154K	probably damaging	Het
Ddr1	T	C	17: 35,682,485	T877A	probably benign	Het
Dnah8	T	A	17: 30,731,038	L1944I	probably benign	Het
Dpf3	G	T	12: 83,370,611	S29*	probably null	Het
Ephb1	A	G	9: 101,971,179	I640T	probably damaging	Het
Fat1	G	A	8: 45,024,282	G2099S	probably damaging	Het
Fbxo41	G	T	6: 85,477,924	N667K	probably damaging	Het
Gart	A	T	16: 91,634,045	D376E	probably benign	Het
Glyr1	G	A	16: 5,018,876	Q475*	probably null	Het
Gm28051	G	A	12: 102,720,171	Q77*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gnmt	C	A	17: 46,726,330	R176L	probably damaging	Het
Gpr176	A	T	2: 118,280,148	V210D	possibly damaging	Het
Gtf2ird1	A	T	5: 134,402,184	D339E	probably damaging	Het
Hmbox1	A	G	14: 64,825,612	Y372H	probably damaging	Het
Ier2	G	T	8: 84,662,732	A7E	probably damaging	Het
Il20ra	A	G	10: 19,758,943	T311A	possibly damaging	Het
Il24	T	C	1: 130,883,442		probably null	Het
Insl6	G	A	19: 29,321,596	Q139*	probably null	Het
Itga2b	A	T	11: 102,458,191	I729K	probably damaging	Het
Itpr2	A	T	6: 146,233,991	M1814K	possibly damaging	Het
Klhl3	G	A	13: 58,018,889	S429F	probably damaging	Het
Lipo2	T	C	19: 33,748,465	N129S	probably benign	Het
Lrba	C	T	3: 86,225,371	T28M	probably benign	Het
Ly86	G	T	13: 37,375,037	G71C	probably damaging	Het
Maob	T	C	X: 16,716,423	T400A	probably benign	Het
Mical2	A	G	7: 112,320,611	S443G	probably damaging	Het
Mmp17	A	G	5: 129,602,165	H376R	possibly damaging	Het
Myo7b	T	C	18: 31,983,587	H989R	probably damaging	Het
Neil2	A	G	14: 63,188,460	W154R	probably damaging	Het
Nlrp12	G	A	7: 3,240,983	H300Y	possibly damaging	Het
Nlrp3	A	T	11: 59,548,728	Y377F	probably damaging	Het
Notch2	T	C	3: 98,101,636		probably null	Het
Nudcd1	A	T	15: 44,376,643	C500*	probably null	Het
Olfr1099	A	T	2: 86,959,354	Y35N	probably damaging	Het
Olfr1164	A	G	2: 88,093,009	V309A	probably damaging	Het
Olfr1449	T	C	19: 12,934,816	V26A	probably benign	Het
Olfr1537	A	G	9: 39,238,421	M1T	probably null	Het
Pabpc6	T	A	17: 9,669,611	S4C	probably damaging	Het
Pan2	C	T	10: 128,315,595	R835*	probably null	Het
Parp9	G	A	16: 35,964,313	V346I	probably damaging	Het
Pcbp4	C	T	9: 106,460,718	T69M	probably damaging	Het
Pclo	T	A	5: 14,677,882		probably benign	Het
Phldb3	A	T	7: 24,624,685	I495F	possibly damaging	Het
Plce1	G	T	19: 38,651,833	V508F	probably benign	Het
Pmpca	A	T	2: 26,395,166	I468F	probably damaging	Het
Pmpcb	G	A	5: 21,756,443	R399H	probably damaging	Het
Ptprc	A	G	1: 138,094,299	S544P	probably damaging	Het
Rev3l	T	A	10: 39,823,330	D1274E	probably benign	Het
Ryr3	A	T	2: 112,902,665	V612E	probably damaging	Het
Scfd2	G	T	5: 74,206,321	H639Q	probably benign	Het
Sell	T	A	1: 164,065,318	H34Q	possibly damaging	Het
Setd2	A	G	9: 110,548,158	D347G	probably benign	Het
Sgip1	G	A	4: 102,869,769	D81N	probably damaging	Het
Slc12a1	A	T	2: 125,218,224	I940F	possibly damaging	Het
Slc25a34	T	A	4: 141,621,458	I232L	probably benign	Het
Slc36a3	T	A	11: 55,148,573	K76N	probably damaging	Het
Slc6a7	T	C	18: 61,007,376	S195G	probably null	Het
Svep1	G	A	4: 58,068,610	Q3059*	probably null	Het
Syce1l	A	C	8: 113,651,642	H56P	probably damaging	Het
Tbc1d2	A	G	4: 46,606,503	V814A	probably damaging	Het
Tbx18	T	A	9: 87,715,687	I265F	probably damaging	Het
Thbs2	T	C	17: 14,670,590		probably null	Het
Ttll1	T	C	15: 83,496,396	H256R	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttyh2	A	T	11: 114,696,757	T195S	probably benign	Het
Unc119b	A	G	5: 115,125,494	L217P	probably damaging	Het
Unc5a	T	C	13: 55,003,418		probably null	Het
Usp6nl	A	G	2: 6,420,903	K152E	probably benign	Het
Vcam1	T	C	3: 116,117,292	R486G	probably benign	Het
Vmn2r1	A	C	3: 64,090,123	Q400P	possibly damaging	Het
Vmn2r80	T	A	10: 79,194,458	V706D	possibly damaging	Het
Vmn2r87	A	T	10: 130,478,553	L388Q	probably damaging	Het
Vwa3a	A	T	7: 120,783,985	Y603F	probably damaging	Het
Zfp850	A	T	7: 27,990,233	C183*	probably null	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAATGCCTAAGAATAGCAAAGTGG -3'
(R):5'- CCCTAGCTTTGTAATGGAATTCAC -3'

Sequencing Primer
(F):5'- TGCCTAAGAATAGCAAAGTGGTAAAG -3'
(R):5'- CTGAAATACAGGATTGCCCTTTACGG -3'

Posted On

2016-06-15