Incidental Mutation 'R5112:Nlrp3'
ID 393952
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 042700-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R5112 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59439554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 377 (Y377F)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably damaging
Transcript: ENSMUST00000079476
AA Change: Y377F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: Y377F

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101148
AA Change: Y377F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: Y377F

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Meta Mutation Damage Score 0.9181 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,328,383 (GRCm39) K846R probably damaging Het
Acsbg3 T A 17: 57,184,465 (GRCm39) M80K probably benign Het
Acsm5 A G 7: 119,136,502 (GRCm39) K358E possibly damaging Het
Adam26a A T 8: 44,021,893 (GRCm39) D532E probably benign Het
Adamts19 C T 18: 59,164,876 (GRCm39) R993* probably null Het
Akr1c13 A G 13: 4,244,151 (GRCm39) K68R possibly damaging Het
Amer3 T A 1: 34,626,157 (GRCm39) M132K possibly damaging Het
Ankrd2 A G 19: 42,028,326 (GRCm39) D38G possibly damaging Het
Ano7 G A 1: 93,325,085 (GRCm39) V546M possibly damaging Het
Aox1 G A 1: 58,349,254 (GRCm39) probably null Het
Apc T A 18: 34,449,162 (GRCm39) C1985* probably null Het
Astn1 C T 1: 158,484,763 (GRCm39) S15F possibly damaging Het
Atp13a4 A T 16: 29,228,686 (GRCm39) N950K possibly damaging Het
Bcl6 A G 16: 23,791,496 (GRCm39) V286A probably benign Het
Brox T A 1: 183,073,541 (GRCm39) T79S probably benign Het
C2cd3 A T 7: 100,092,692 (GRCm39) I512F possibly damaging Het
Camta1 A G 4: 151,158,511 (GRCm39) L542S probably damaging Het
Capn13 GCA G 17: 73,658,501 (GRCm39) probably null Het
Card10 C T 15: 78,686,580 (GRCm39) probably null Het
Cd96 A G 16: 45,919,301 (GRCm39) M240T probably benign Het
Cdc123 A G 2: 5,809,748 (GRCm39) L221P possibly damaging Het
Cdh19 A G 1: 110,882,354 (GRCm39) V46A possibly damaging Het
Clcn3 G A 8: 61,407,586 (GRCm39) H24Y probably benign Het
Col11a2 T C 17: 34,283,062 (GRCm39) probably benign Het
Cpsf3 A T 12: 21,341,785 (GRCm39) M50L probably benign Het
Csf3 T A 11: 98,593,749 (GRCm39) L197Q probably damaging Het
Ctsw T A 19: 5,516,285 (GRCm39) D196V probably damaging Het
Dcun1d3 A T 7: 119,457,250 (GRCm39) I154K probably damaging Het
Ddr1 T C 17: 35,993,377 (GRCm39) T877A probably benign Het
Dnah8 T A 17: 30,950,012 (GRCm39) L1944I probably benign Het
Dpf3 G T 12: 83,417,385 (GRCm39) S29* probably null Het
Ephb1 A G 9: 101,848,378 (GRCm39) I640T probably damaging Het
Fat1 G A 8: 45,477,319 (GRCm39) G2099S probably damaging Het
Fbxo41 G T 6: 85,454,906 (GRCm39) N667K probably damaging Het
Flacc1 T C 1: 58,698,441 (GRCm39) T326A probably benign Het
Gart A T 16: 91,430,933 (GRCm39) D376E probably benign Het
Glyr1 G A 16: 4,836,740 (GRCm39) Q475* probably null Het
Gm28051 G A 12: 102,686,430 (GRCm39) Q77* probably null Het
Gnmt C A 17: 47,037,256 (GRCm39) R176L probably damaging Het
Gpr176 A T 2: 118,110,629 (GRCm39) V210D possibly damaging Het
Gtf2ird1 A T 5: 134,431,038 (GRCm39) D339E probably damaging Het
Hmbox1 A G 14: 65,063,061 (GRCm39) Y372H probably damaging Het
Ier2 G T 8: 85,389,361 (GRCm39) A7E probably damaging Het
Il20ra A G 10: 19,634,691 (GRCm39) T311A possibly damaging Het
Il24 T C 1: 130,811,179 (GRCm39) probably null Het
Insl6 G A 19: 29,298,996 (GRCm39) Q139* probably null Het
Itga2b A T 11: 102,349,017 (GRCm39) I729K probably damaging Het
Itpr2 A T 6: 146,135,489 (GRCm39) M1814K possibly damaging Het
Klhl3 G A 13: 58,166,703 (GRCm39) S429F probably damaging Het
Lipo2 T C 19: 33,725,865 (GRCm39) N129S probably benign Het
Lrba C T 3: 86,132,678 (GRCm39) T28M probably benign Het
Ly86 G T 13: 37,559,013 (GRCm39) G71C probably damaging Het
Maob T C X: 16,582,662 (GRCm39) T400A probably benign Het
Mical2 A G 7: 111,919,818 (GRCm39) S443G probably damaging Het
Mmp17 A G 5: 129,679,229 (GRCm39) H376R possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Myo7b T C 18: 32,116,640 (GRCm39) H989R probably damaging Het
Neil2 A G 14: 63,425,909 (GRCm39) W154R probably damaging Het
Nlrp12 G A 7: 3,289,613 (GRCm39) H300Y possibly damaging Het
Notch2 T C 3: 98,008,952 (GRCm39) probably null Het
Nudcd1 A T 15: 44,240,039 (GRCm39) C500* probably null Het
Or5b24 T C 19: 12,912,180 (GRCm39) V26A probably benign Het
Or5d37 A G 2: 87,923,353 (GRCm39) V309A probably damaging Het
Or8g18 A G 9: 39,149,717 (GRCm39) M1T probably null Het
Or8h9 A T 2: 86,789,698 (GRCm39) Y35N probably damaging Het
Pabpc6 T A 17: 9,888,540 (GRCm39) S4C probably damaging Het
Pan2 C T 10: 128,151,464 (GRCm39) R835* probably null Het
Parp9 G A 16: 35,784,683 (GRCm39) V346I probably damaging Het
Pcbp4 C T 9: 106,337,917 (GRCm39) T69M probably damaging Het
Pclo T A 5: 14,727,896 (GRCm39) probably benign Het
Phldb3 A T 7: 24,324,110 (GRCm39) I495F possibly damaging Het
Plce1 G T 19: 38,640,277 (GRCm39) V508F probably benign Het
Pmpca A T 2: 26,285,178 (GRCm39) I468F probably damaging Het
Pmpcb G A 5: 21,961,441 (GRCm39) R399H probably damaging Het
Ptprc A G 1: 138,022,037 (GRCm39) S544P probably damaging Het
Rev3l T A 10: 39,699,326 (GRCm39) D1274E probably benign Het
Ryr3 A T 2: 112,733,010 (GRCm39) V612E probably damaging Het
Scfd2 G T 5: 74,366,982 (GRCm39) H639Q probably benign Het
Sell T A 1: 163,892,887 (GRCm39) H34Q possibly damaging Het
Setd2 A G 9: 110,377,226 (GRCm39) D347G probably benign Het
Sgip1 G A 4: 102,726,966 (GRCm39) D81N probably damaging Het
Slc12a1 A T 2: 125,060,144 (GRCm39) I940F possibly damaging Het
Slc25a34 T A 4: 141,348,769 (GRCm39) I232L probably benign Het
Slc36a3 T A 11: 55,039,399 (GRCm39) K76N probably damaging Het
Slc6a15 T A 10: 103,225,087 (GRCm39) D58E probably benign Het
Slc6a7 T C 18: 61,140,448 (GRCm39) S195G probably null Het
Svep1 G A 4: 58,068,610 (GRCm39) Q3059* probably null Het
Syce1l A C 8: 114,378,274 (GRCm39) H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 (GRCm39) V814A probably damaging Het
Tbx18 T A 9: 87,597,740 (GRCm39) I265F probably damaging Het
Thbs2 T C 17: 14,890,852 (GRCm39) probably null Het
Ttll1 T C 15: 83,380,597 (GRCm39) H256R probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttyh2 A T 11: 114,587,583 (GRCm39) T195S probably benign Het
Unc119b A G 5: 115,263,553 (GRCm39) L217P probably damaging Het
Unc5a T C 13: 55,151,231 (GRCm39) probably null Het
Usp6nl A G 2: 6,425,714 (GRCm39) K152E probably benign Het
Vcam1 T C 3: 115,910,941 (GRCm39) R486G probably benign Het
Vmn2r1 A C 3: 63,997,544 (GRCm39) Q400P possibly damaging Het
Vmn2r80 T A 10: 79,030,292 (GRCm39) V706D possibly damaging Het
Vmn2r87 A T 10: 130,314,422 (GRCm39) L388Q probably damaging Het
Vwa3a A T 7: 120,383,208 (GRCm39) Y603F probably damaging Het
Zfp850 A T 7: 27,689,658 (GRCm39) C183* probably null Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CAGACTGGCAAAAGGCTGTG -3'
(R):5'- AGAGAAGAGATGCTCCTCAATGC -3'

Sequencing Primer
(F):5'- TGCGGGGAGACATTCTGCTAAG -3'
(R):5'- ACGTAGACGGCCGTAGTG -3'
Posted On 2016-06-15