Incidental Mutation 'R0446:Krt20'
ID39397
Institutional Source Beutler Lab
Gene Symbol Krt20
Ensembl Gene ENSMUSG00000035775
Gene Namekeratin 20
SynonymsCK20, 9030623C06Rik, cytokeratin 20
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99428403-99438150 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 99437776 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 108 (Q108*)
Ref Sequence ENSEMBL: ENSMUSP00000017743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017743]
Predicted Effect probably null
Transcript: ENSMUST00000017743
AA Change: Q108*
SMART Domains Protein: ENSMUSP00000017743
Gene: ENSMUSG00000035775
AA Change: Q108*

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Filament 76 387 7.19e-146 SMART
low complexity region 410 431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the keratin protein family and is found within a cluster of cytokeratin genes on chromosome 11. Keratins are cytoskeletal proteins that are preferentially expressed in epithelial cells. The encoded protein may help maintain intermediate filament organization in intestinal epithelium. Phosphorylation of this protein may also influence mucin secretion in the small intestine. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Krt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Krt20 APN 11 99431943 missense probably benign 0.01
IGL01926:Krt20 APN 11 99437826 missense probably damaging 1.00
IGL02105:Krt20 APN 11 99438001 missense probably benign 0.01
IGL03225:Krt20 APN 11 99431930 missense probably damaging 0.97
IGL03274:Krt20 APN 11 99430029 splice site probably benign
IGL03331:Krt20 APN 11 99435430 splice site probably null
R0091:Krt20 UTSW 11 99437814 missense probably damaging 1.00
R3955:Krt20 UTSW 11 99432211 nonsense probably null
R4805:Krt20 UTSW 11 99428985 missense unknown
R5156:Krt20 UTSW 11 99430053 missense possibly damaging 0.92
R5620:Krt20 UTSW 11 99435457 missense probably damaging 1.00
R6716:Krt20 UTSW 11 99431928 missense possibly damaging 0.77
R7006:Krt20 UTSW 11 99437761 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CTGTAATCTGTATCCACCCTGAACCCT -3'
(R):5'- GCATCTCTGTCTCCAAAGCCGTAA -3'

Sequencing Primer
(F):5'- CTCACATATAGAAACCATTGGAGGTC -3'
(R):5'- GTCTCCAAAGCCGTAATGAGC -3'
Posted On2013-05-23