Incidental Mutation 'R5112:Acsbg3'
ID 393979
Institutional Source Beutler Lab
Gene Symbol Acsbg3
Ensembl Gene ENSMUSG00000024209
Gene Name acyl-CoA synthetase bubblegum family member 3
Synonyms 1700061G19Rik
MMRRC Submission 042700-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5112 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 57182477-57195904 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57184465 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 80 (M80K)
Ref Sequence ENSEMBL: ENSMUSP00000025048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048] [ENSMUST00000043062]
AlphaFold Q08EE8
Predicted Effect probably benign
Transcript: ENSMUST00000025048
AA Change: M80K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209
AA Change: M80K

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043062
SMART Domains Protein: ENSMUSP00000042352
Gene: ENSMUSG00000024207

DomainStartEndE-ValueType
Pfam:AMP-binding 53 519 7e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125425
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,328,383 (GRCm39) K846R probably damaging Het
Acsm5 A G 7: 119,136,502 (GRCm39) K358E possibly damaging Het
Adam26a A T 8: 44,021,893 (GRCm39) D532E probably benign Het
Adamts19 C T 18: 59,164,876 (GRCm39) R993* probably null Het
Akr1c13 A G 13: 4,244,151 (GRCm39) K68R possibly damaging Het
Amer3 T A 1: 34,626,157 (GRCm39) M132K possibly damaging Het
Ankrd2 A G 19: 42,028,326 (GRCm39) D38G possibly damaging Het
Ano7 G A 1: 93,325,085 (GRCm39) V546M possibly damaging Het
Aox1 G A 1: 58,349,254 (GRCm39) probably null Het
Apc T A 18: 34,449,162 (GRCm39) C1985* probably null Het
Astn1 C T 1: 158,484,763 (GRCm39) S15F possibly damaging Het
Atp13a4 A T 16: 29,228,686 (GRCm39) N950K possibly damaging Het
Bcl6 A G 16: 23,791,496 (GRCm39) V286A probably benign Het
Brox T A 1: 183,073,541 (GRCm39) T79S probably benign Het
C2cd3 A T 7: 100,092,692 (GRCm39) I512F possibly damaging Het
Camta1 A G 4: 151,158,511 (GRCm39) L542S probably damaging Het
Capn13 GCA G 17: 73,658,501 (GRCm39) probably null Het
Card10 C T 15: 78,686,580 (GRCm39) probably null Het
Cd96 A G 16: 45,919,301 (GRCm39) M240T probably benign Het
Cdc123 A G 2: 5,809,748 (GRCm39) L221P possibly damaging Het
Cdh19 A G 1: 110,882,354 (GRCm39) V46A possibly damaging Het
Clcn3 G A 8: 61,407,586 (GRCm39) H24Y probably benign Het
Col11a2 T C 17: 34,283,062 (GRCm39) probably benign Het
Cpsf3 A T 12: 21,341,785 (GRCm39) M50L probably benign Het
Csf3 T A 11: 98,593,749 (GRCm39) L197Q probably damaging Het
Ctsw T A 19: 5,516,285 (GRCm39) D196V probably damaging Het
Dcun1d3 A T 7: 119,457,250 (GRCm39) I154K probably damaging Het
Ddr1 T C 17: 35,993,377 (GRCm39) T877A probably benign Het
Dnah8 T A 17: 30,950,012 (GRCm39) L1944I probably benign Het
Dpf3 G T 12: 83,417,385 (GRCm39) S29* probably null Het
Ephb1 A G 9: 101,848,378 (GRCm39) I640T probably damaging Het
Fat1 G A 8: 45,477,319 (GRCm39) G2099S probably damaging Het
Fbxo41 G T 6: 85,454,906 (GRCm39) N667K probably damaging Het
Flacc1 T C 1: 58,698,441 (GRCm39) T326A probably benign Het
Gart A T 16: 91,430,933 (GRCm39) D376E probably benign Het
Glyr1 G A 16: 4,836,740 (GRCm39) Q475* probably null Het
Gm28051 G A 12: 102,686,430 (GRCm39) Q77* probably null Het
Gnmt C A 17: 47,037,256 (GRCm39) R176L probably damaging Het
Gpr176 A T 2: 118,110,629 (GRCm39) V210D possibly damaging Het
Gtf2ird1 A T 5: 134,431,038 (GRCm39) D339E probably damaging Het
Hmbox1 A G 14: 65,063,061 (GRCm39) Y372H probably damaging Het
Ier2 G T 8: 85,389,361 (GRCm39) A7E probably damaging Het
Il20ra A G 10: 19,634,691 (GRCm39) T311A possibly damaging Het
Il24 T C 1: 130,811,179 (GRCm39) probably null Het
Insl6 G A 19: 29,298,996 (GRCm39) Q139* probably null Het
Itga2b A T 11: 102,349,017 (GRCm39) I729K probably damaging Het
Itpr2 A T 6: 146,135,489 (GRCm39) M1814K possibly damaging Het
Klhl3 G A 13: 58,166,703 (GRCm39) S429F probably damaging Het
Lipo2 T C 19: 33,725,865 (GRCm39) N129S probably benign Het
Lrba C T 3: 86,132,678 (GRCm39) T28M probably benign Het
Ly86 G T 13: 37,559,013 (GRCm39) G71C probably damaging Het
Maob T C X: 16,582,662 (GRCm39) T400A probably benign Het
Mical2 A G 7: 111,919,818 (GRCm39) S443G probably damaging Het
Mmp17 A G 5: 129,679,229 (GRCm39) H376R possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Myo7b T C 18: 32,116,640 (GRCm39) H989R probably damaging Het
Neil2 A G 14: 63,425,909 (GRCm39) W154R probably damaging Het
Nlrp12 G A 7: 3,289,613 (GRCm39) H300Y possibly damaging Het
Nlrp3 A T 11: 59,439,554 (GRCm39) Y377F probably damaging Het
Notch2 T C 3: 98,008,952 (GRCm39) probably null Het
Nudcd1 A T 15: 44,240,039 (GRCm39) C500* probably null Het
Or5b24 T C 19: 12,912,180 (GRCm39) V26A probably benign Het
Or5d37 A G 2: 87,923,353 (GRCm39) V309A probably damaging Het
Or8g18 A G 9: 39,149,717 (GRCm39) M1T probably null Het
Or8h9 A T 2: 86,789,698 (GRCm39) Y35N probably damaging Het
Pabpc6 T A 17: 9,888,540 (GRCm39) S4C probably damaging Het
Pan2 C T 10: 128,151,464 (GRCm39) R835* probably null Het
Parp9 G A 16: 35,784,683 (GRCm39) V346I probably damaging Het
Pcbp4 C T 9: 106,337,917 (GRCm39) T69M probably damaging Het
Pclo T A 5: 14,727,896 (GRCm39) probably benign Het
Phldb3 A T 7: 24,324,110 (GRCm39) I495F possibly damaging Het
Plce1 G T 19: 38,640,277 (GRCm39) V508F probably benign Het
Pmpca A T 2: 26,285,178 (GRCm39) I468F probably damaging Het
Pmpcb G A 5: 21,961,441 (GRCm39) R399H probably damaging Het
Ptprc A G 1: 138,022,037 (GRCm39) S544P probably damaging Het
Rev3l T A 10: 39,699,326 (GRCm39) D1274E probably benign Het
Ryr3 A T 2: 112,733,010 (GRCm39) V612E probably damaging Het
Scfd2 G T 5: 74,366,982 (GRCm39) H639Q probably benign Het
Sell T A 1: 163,892,887 (GRCm39) H34Q possibly damaging Het
Setd2 A G 9: 110,377,226 (GRCm39) D347G probably benign Het
Sgip1 G A 4: 102,726,966 (GRCm39) D81N probably damaging Het
Slc12a1 A T 2: 125,060,144 (GRCm39) I940F possibly damaging Het
Slc25a34 T A 4: 141,348,769 (GRCm39) I232L probably benign Het
Slc36a3 T A 11: 55,039,399 (GRCm39) K76N probably damaging Het
Slc6a15 T A 10: 103,225,087 (GRCm39) D58E probably benign Het
Slc6a7 T C 18: 61,140,448 (GRCm39) S195G probably null Het
Svep1 G A 4: 58,068,610 (GRCm39) Q3059* probably null Het
Syce1l A C 8: 114,378,274 (GRCm39) H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 (GRCm39) V814A probably damaging Het
Tbx18 T A 9: 87,597,740 (GRCm39) I265F probably damaging Het
Thbs2 T C 17: 14,890,852 (GRCm39) probably null Het
Ttll1 T C 15: 83,380,597 (GRCm39) H256R probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttyh2 A T 11: 114,587,583 (GRCm39) T195S probably benign Het
Unc119b A G 5: 115,263,553 (GRCm39) L217P probably damaging Het
Unc5a T C 13: 55,151,231 (GRCm39) probably null Het
Usp6nl A G 2: 6,425,714 (GRCm39) K152E probably benign Het
Vcam1 T C 3: 115,910,941 (GRCm39) R486G probably benign Het
Vmn2r1 A C 3: 63,997,544 (GRCm39) Q400P possibly damaging Het
Vmn2r80 T A 10: 79,030,292 (GRCm39) V706D possibly damaging Het
Vmn2r87 A T 10: 130,314,422 (GRCm39) L388Q probably damaging Het
Vwa3a A T 7: 120,383,208 (GRCm39) Y603F probably damaging Het
Zfp850 A T 7: 27,689,658 (GRCm39) C183* probably null Het
Other mutations in Acsbg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Acsbg3 APN 17 57,189,203 (GRCm39) nonsense probably null
IGL01833:Acsbg3 APN 17 57,188,062 (GRCm39) missense probably benign 0.02
IGL02420:Acsbg3 APN 17 57,187,494 (GRCm39) missense probably damaging 1.00
IGL02969:Acsbg3 APN 17 57,190,751 (GRCm39) missense probably damaging 1.00
IGL03054:Acsbg3 UTSW 17 57,193,528 (GRCm39) missense possibly damaging 0.67
R0197:Acsbg3 UTSW 17 57,190,835 (GRCm39) missense probably benign 0.01
R0257:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0279:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0280:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0281:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0282:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0329:Acsbg3 UTSW 17 57,190,631 (GRCm39) missense probably benign 0.02
R0330:Acsbg3 UTSW 17 57,190,631 (GRCm39) missense probably benign 0.02
R0349:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0518:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0519:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0521:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0604:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0883:Acsbg3 UTSW 17 57,190,835 (GRCm39) missense probably benign 0.01
R1561:Acsbg3 UTSW 17 57,184,431 (GRCm39) missense probably benign
R1779:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R2008:Acsbg3 UTSW 17 57,193,478 (GRCm39) missense probably benign 0.04
R2102:Acsbg3 UTSW 17 57,191,949 (GRCm39) nonsense probably null
R2247:Acsbg3 UTSW 17 57,184,435 (GRCm39) missense possibly damaging 0.83
R2484:Acsbg3 UTSW 17 57,189,641 (GRCm39) missense probably benign 0.00
R2917:Acsbg3 UTSW 17 57,192,141 (GRCm39) missense probably damaging 1.00
R3149:Acsbg3 UTSW 17 57,183,348 (GRCm39) missense probably benign
R3773:Acsbg3 UTSW 17 57,183,262 (GRCm39) start codon destroyed probably null 0.00
R4829:Acsbg3 UTSW 17 57,190,500 (GRCm39) splice site probably null
R4860:Acsbg3 UTSW 17 57,195,655 (GRCm39) missense probably benign 0.09
R4860:Acsbg3 UTSW 17 57,195,655 (GRCm39) missense probably benign 0.09
R4887:Acsbg3 UTSW 17 57,183,324 (GRCm39) missense possibly damaging 0.84
R5043:Acsbg3 UTSW 17 57,192,198 (GRCm39) missense probably damaging 1.00
R5161:Acsbg3 UTSW 17 57,189,888 (GRCm39) missense possibly damaging 0.84
R5214:Acsbg3 UTSW 17 57,193,493 (GRCm39) missense probably benign
R5287:Acsbg3 UTSW 17 57,183,221 (GRCm39) unclassified probably benign
R5403:Acsbg3 UTSW 17 57,183,221 (GRCm39) unclassified probably benign
R5779:Acsbg3 UTSW 17 57,188,061 (GRCm39) missense probably benign 0.02
R5997:Acsbg3 UTSW 17 57,183,373 (GRCm39) missense probably benign 0.02
R6198:Acsbg3 UTSW 17 57,189,679 (GRCm39) missense probably damaging 1.00
R6259:Acsbg3 UTSW 17 57,184,513 (GRCm39) missense probably benign 0.04
R6357:Acsbg3 UTSW 17 57,184,591 (GRCm39) critical splice donor site probably null
R6754:Acsbg3 UTSW 17 57,190,358 (GRCm39) missense probably damaging 0.99
R6842:Acsbg3 UTSW 17 57,184,432 (GRCm39) missense probably benign 0.00
R7042:Acsbg3 UTSW 17 57,192,098 (GRCm39) missense possibly damaging 0.73
R7181:Acsbg3 UTSW 17 57,188,037 (GRCm39) missense probably benign 0.03
R7445:Acsbg3 UTSW 17 57,189,973 (GRCm39) missense possibly damaging 0.64
R7511:Acsbg3 UTSW 17 57,189,954 (GRCm39) missense probably damaging 0.98
R8122:Acsbg3 UTSW 17 57,193,670 (GRCm39) missense possibly damaging 0.50
R8553:Acsbg3 UTSW 17 57,188,021 (GRCm39) missense probably benign 0.02
R8919:Acsbg3 UTSW 17 57,189,218 (GRCm39) missense probably benign 0.00
R9460:Acsbg3 UTSW 17 57,183,316 (GRCm39) missense probably damaging 0.99
R9469:Acsbg3 UTSW 17 57,183,283 (GRCm39) missense probably benign 0.00
R9766:Acsbg3 UTSW 17 57,189,177 (GRCm39) missense probably benign 0.02
Z1177:Acsbg3 UTSW 17 57,190,463 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGACAATGACTCCCTGTTC -3'
(R):5'- AGAGGGATGTGTCACCTGTG -3'

Sequencing Primer
(F):5'- GGAAGTGACTTCTGACCTTCTGC -3'
(R):5'- GGACTTGCTTGCACAGGAG -3'
Posted On 2016-06-15