Incidental Mutation 'R5112:Adamts19'
ID393983
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19
SynonymsD230034E10Rik
MMRRC Submission 042700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5112 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location58836764-59053678 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 59031804 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 993 (R993*)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
Predicted Effect probably null
Transcript: ENSMUST00000052907
AA Change: R993*
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: R993*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,877,465 M80K probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acsm5 A G 7: 119,537,279 K358E possibly damaging Het
Adam26a A T 8: 43,568,856 D532E probably benign Het
Akr1c13 A G 13: 4,194,152 K68R possibly damaging Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Amer3 T A 1: 34,587,076 M132K possibly damaging Het
Ankrd2 A G 19: 42,039,887 D38G possibly damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Apc T A 18: 34,316,109 C1985* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Atp13a4 A T 16: 29,409,868 N950K possibly damaging Het
Bcl6 A G 16: 23,972,746 V286A probably benign Het
Brox T A 1: 183,291,977 T79S probably benign Het
C2cd3 A T 7: 100,443,485 I512F possibly damaging Het
Camta1 A G 4: 151,074,054 L542S probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Cd96 A G 16: 46,098,938 M240T probably benign Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Clcn3 G A 8: 60,954,552 H24Y probably benign Het
Col11a2 T C 17: 34,064,088 probably benign Het
Cpsf3 A T 12: 21,291,784 M50L probably benign Het
Csf3 T A 11: 98,702,923 L197Q probably damaging Het
Ctsw T A 19: 5,466,257 D196V probably damaging Het
Dcun1d3 A T 7: 119,858,027 I154K probably damaging Het
Ddr1 T C 17: 35,682,485 T877A probably benign Het
Dnah8 T A 17: 30,731,038 L1944I probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Ephb1 A G 9: 101,971,179 I640T probably damaging Het
Fat1 G A 8: 45,024,282 G2099S probably damaging Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gart A T 16: 91,634,045 D376E probably benign Het
Glyr1 G A 16: 5,018,876 Q475* probably null Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnmt C A 17: 46,726,330 R176L probably damaging Het
Gpr176 A T 2: 118,280,148 V210D possibly damaging Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Hmbox1 A G 14: 64,825,612 Y372H probably damaging Het
Ier2 G T 8: 84,662,732 A7E probably damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Insl6 G A 19: 29,321,596 Q139* probably null Het
Itga2b A T 11: 102,458,191 I729K probably damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Klhl3 G A 13: 58,018,889 S429F probably damaging Het
Lipo2 T C 19: 33,748,465 N129S probably benign Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Ly86 G T 13: 37,375,037 G71C probably damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Mical2 A G 7: 112,320,611 S443G probably damaging Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Myo7b T C 18: 31,983,587 H989R probably damaging Het
Neil2 A G 14: 63,188,460 W154R probably damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr1449 T C 19: 12,934,816 V26A probably benign Het
Olfr1537 A G 9: 39,238,421 M1T probably null Het
Pabpc6 T A 17: 9,669,611 S4C probably damaging Het
Pan2 C T 10: 128,315,595 R835* probably null Het
Parp9 G A 16: 35,964,313 V346I probably damaging Het
Pcbp4 C T 9: 106,460,718 T69M probably damaging Het
Pclo T A 5: 14,677,882 probably benign Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Plce1 G T 19: 38,651,833 V508F probably benign Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Ryr3 A T 2: 112,902,665 V612E probably damaging Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sgip1 G A 4: 102,869,769 D81N probably damaging Het
Slc12a1 A T 2: 125,218,224 I940F possibly damaging Het
Slc25a34 T A 4: 141,621,458 I232L probably benign Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a15 T A 10: 103,389,226 D58E probably benign Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Svep1 G A 4: 58,068,610 Q3059* probably null Het
Syce1l A C 8: 113,651,642 H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 V814A probably damaging Het
Tbx18 T A 9: 87,715,687 I265F probably damaging Het
Thbs2 T C 17: 14,670,590 probably null Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Unc5a T C 13: 55,003,418 probably null Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r80 T A 10: 79,194,458 V706D possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Vwa3a A T 7: 120,783,985 Y603F probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59024465 missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59007325 splice site probably benign
IGL00970:Adamts19 APN 18 59011077 missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59048882 missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 58972779 missense probably damaging 0.98
IGL01529:Adamts19 APN 18 58963463 missense probably damaging 0.99
IGL01535:Adamts19 APN 18 58968819 missense probably benign 0.00
IGL01557:Adamts19 APN 18 58968720 splice site probably null
IGL01705:Adamts19 APN 18 59032966 missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 58952469 missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58837499 missense probably benign
IGL02131:Adamts19 APN 18 59052660 missense probably damaging 1.00
IGL02312:Adamts19 APN 18 58927297 missense probably damaging 1.00
IGL02755:Adamts19 APN 18 58969933 missense probably benign 0.25
IGL02866:Adamts19 APN 18 59048842 missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 58988965 missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59024518 missense probably damaging 1.00
IGL03040:Adamts19 APN 18 58903008 missense probably benign 0.05
R0081:Adamts19 UTSW 18 58903065 critical splice donor site probably null
R0194:Adamts19 UTSW 18 59011148 missense probably null 1.00
R0195:Adamts19 UTSW 18 58969870 splice site probably benign
R0541:Adamts19 UTSW 18 58927300 critical splice donor site probably null
R0659:Adamts19 UTSW 18 59007493 splice site probably benign
R0967:Adamts19 UTSW 18 58972740 nonsense probably null
R1512:Adamts19 UTSW 18 59048845 missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59052615 missense probably damaging 1.00
R1582:Adamts19 UTSW 18 58969941 missense probably damaging 0.98
R1629:Adamts19 UTSW 18 58954619 missense probably damaging 0.97
R1653:Adamts19 UTSW 18 58890293 missense probably benign 0.00
R1718:Adamts19 UTSW 18 58972825 missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59031929 missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59007372 missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 58954620 missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59032945 missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 58970006 missense probably benign 0.09
R1994:Adamts19 UTSW 18 58972831 critical splice donor site probably null
R2177:Adamts19 UTSW 18 58954554 missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 58900910 missense probably damaging 1.00
R4342:Adamts19 UTSW 18 58942500 missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58837776 missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 58890284 missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59033000 missense probably damaging 1.00
R5116:Adamts19 UTSW 18 58902994 missense possibly damaging 0.52
R5205:Adamts19 UTSW 18 58968808 missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59052582 missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58837968 missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58837512 missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 58968774 missense probably benign 0.18
R6088:Adamts19 UTSW 18 58902102 missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58837640 nonsense probably null
R7251:Adamts19 UTSW 18 58837902 missense probably damaging 1.00
R7295:Adamts19 UTSW 18 58837883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACATTCAGGGAAATGCAC -3'
(R):5'- AACCGTCATGTGTAGTGATTGG -3'

Sequencing Primer
(F):5'- TTCAGGGAAATGCACAAGGTGATTAC -3'
(R):5'- ATGGAGTAAGGACCGCACCTC -3'
Posted On2016-06-15