Incidental Mutation 'R0446:Lyst'
ID 39399
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission 038647-MU
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448
Essential gene? Possibly non essential (E-score: 0.300) question?
Stock # R0446 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 13590397-13778803 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13638048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1015 (M1015K)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110559
AA Change: M1015K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: M1015K

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223527
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
pardon UTSW 13 13677952 missense probably benign 0.00
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683223 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
R7018:Lyst UTSW 13 13743459 critical splice donor site probably null
R7037:Lyst UTSW 13 13616666 missense probably damaging 1.00
R7045:Lyst UTSW 13 13634900 missense probably benign 0.34
R7045:Lyst UTSW 13 13637708 missense probably damaging 1.00
R7070:Lyst UTSW 13 13757444 missense probably benign 0.23
R7188:Lyst UTSW 13 13752090 missense possibly damaging 0.66
R7201:Lyst UTSW 13 13709300 nonsense probably null
R7210:Lyst UTSW 13 13656983 missense probably damaging 1.00
R7229:Lyst UTSW 13 13643509 missense probably benign 0.00
R7293:Lyst UTSW 13 13680237 missense probably benign 0.01
R7318:Lyst UTSW 13 13757443 missense probably benign 0.13
R7344:Lyst UTSW 13 13706555 missense probably benign
R7426:Lyst UTSW 13 13637524 missense probably benign
R7522:Lyst UTSW 13 13647083 nonsense probably null
R7583:Lyst UTSW 13 13635887 missense probably damaging 1.00
R7606:Lyst UTSW 13 13637475 missense probably damaging 1.00
R7636:Lyst UTSW 13 13616747 critical splice donor site probably null
R7658:Lyst UTSW 13 13730476 missense possibly damaging 0.63
R7685:Lyst UTSW 13 13669865 missense probably benign 0.00
R7689:Lyst UTSW 13 13683223 critical splice donor site probably null
R7765:Lyst UTSW 13 13709532 missense possibly damaging 0.75
R7779:Lyst UTSW 13 13634543 missense probably damaging 1.00
R7871:Lyst UTSW 13 13636052 nonsense probably null
R7872:Lyst UTSW 13 13635865 missense probably benign 0.14
R7884:Lyst UTSW 13 13707683 missense probably benign 0.09
R7890:Lyst UTSW 13 13740569 missense probably damaging 0.99
R7916:Lyst UTSW 13 13647072 missense possibly damaging 0.64
R7948:Lyst UTSW 13 13746589 missense possibly damaging 0.59
R7956:Lyst UTSW 13 13641203 missense possibly damaging 0.80
R8048:Lyst UTSW 13 13687645 missense probably benign 0.12
R8085:Lyst UTSW 13 13634309 missense probably damaging 0.98
R8165:Lyst UTSW 13 13698360 missense probably damaging 0.99
R8235:Lyst UTSW 13 13760738 missense possibly damaging 0.69
R8237:Lyst UTSW 13 13651732 missense probably benign 0.00
R8275:Lyst UTSW 13 13776082 missense probably benign 0.02
R8300:Lyst UTSW 13 13664058 missense possibly damaging 0.79
R8350:Lyst UTSW 13 13650388 nonsense probably null
R8526:Lyst UTSW 13 13760806 missense probably damaging 0.99
R8551:Lyst UTSW 13 13634060 missense possibly damaging 0.77
R8723:Lyst UTSW 13 13712757 missense possibly damaging 0.89
R8772:Lyst UTSW 13 13637492 nonsense probably null
R8778:Lyst UTSW 13 13635776 missense possibly damaging 0.89
R8778:Lyst UTSW 13 13728567 missense possibly damaging 0.89
R8801:Lyst UTSW 13 13661010 missense probably benign 0.10
R8837:Lyst UTSW 13 13677963 missense probably benign
R8874:Lyst UTSW 13 13637562 missense probably benign
R8878:Lyst UTSW 13 13641076 missense probably benign 0.00
R8891:Lyst UTSW 13 13712850 missense possibly damaging 0.67
R9077:Lyst UTSW 13 13683108 missense probably benign 0.02
R9127:Lyst UTSW 13 13634242 missense probably damaging 1.00
R9143:Lyst UTSW 13 13661165 missense probably damaging 0.98
R9216:Lyst UTSW 13 13648603 missense probably benign
R9217:Lyst UTSW 13 13696660 missense probably benign 0.01
R9291:Lyst UTSW 13 13709353 missense probably benign 0.01
R9302:Lyst UTSW 13 13730362 missense possibly damaging 0.46
R9370:Lyst UTSW 13 13760748 missense probably damaging 1.00
R9402:Lyst UTSW 13 13637878 missense probably benign
R9457:Lyst UTSW 13 13687745 missense possibly damaging 0.83
R9481:Lyst UTSW 13 13683068 missense possibly damaging 0.68
R9563:Lyst UTSW 13 13637823 missense probably benign 0.36
R9623:Lyst UTSW 13 13678002 missense probably benign
R9661:Lyst UTSW 13 13634194 missense probably benign 0.01
R9682:Lyst UTSW 13 13656941 missense probably benign 0.21
R9743:Lyst UTSW 13 13634738 missense possibly damaging 0.67
R9801:Lyst UTSW 13 13634705 missense probably damaging 0.97
RF001:Lyst UTSW 13 13635841 missense probably benign
RF002:Lyst UTSW 13 13634363 missense probably benign 0.05
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Z1176:Lyst UTSW 13 13640107 missense probably damaging 1.00
Z1176:Lyst UTSW 13 13777079 missense probably benign 0.27
Z1177:Lyst UTSW 13 13680134 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCACTGCCAGTGAGCCATTAAG -3'
(R):5'- TCCCCAGGAACAGATTCAGTAGCC -3'

Sequencing Primer
(F):5'- GAATGTTTGCACCATGCAGC -3'
(R):5'- AGTAGCCACAATCTGCTCTG -3'
Posted On 2013-05-23