Incidental Mutation 'R5113:Ano3'
ID 393999
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms B230324K02Rik, Tmem16c
MMRRC Submission 042701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5113 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 110485546-110780854 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110491825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 867 (N867K)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000099623
AA Change: N867K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: N867K

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,206,821 (GRCm39) V622A possibly damaging Het
Ankef1 A G 2: 136,394,361 (GRCm39) N590S probably benign Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ash1l T C 3: 88,973,582 (GRCm39) V2547A probably damaging Het
Chil5 A T 3: 105,925,294 (GRCm39) V209E possibly damaging Het
Cltc A T 11: 86,613,147 (GRCm39) C459S probably damaging Het
Col6a4 T A 9: 105,944,159 (GRCm39) D1105V possibly damaging Het
Cyp2c66 A G 19: 39,151,882 (GRCm39) D199G probably benign Het
Cyp4f18 A G 8: 72,742,902 (GRCm39) probably null Het
Cysrt1 A T 2: 25,129,363 (GRCm39) C50S possibly damaging Het
Dapk1 A G 13: 60,869,592 (GRCm39) K278R probably benign Het
Eefsec C A 6: 88,258,557 (GRCm39) S512I probably damaging Het
Emilin1 T C 5: 31,077,964 (GRCm39) F908L possibly damaging Het
Eml1 T C 12: 108,503,596 (GRCm39) V731A possibly damaging Het
Erc2 T C 14: 27,374,829 (GRCm39) S16P probably benign Het
Gfpt2 A G 11: 49,714,626 (GRCm39) R342G probably damaging Het
Gpr142 A T 11: 114,695,143 (GRCm39) Q36L probably benign Het
Grik5 A G 7: 24,714,952 (GRCm39) S681P probably damaging Het
Hecw1 A T 13: 14,520,614 (GRCm39) S208T possibly damaging Het
Hmgcr G A 13: 96,793,240 (GRCm39) A464V probably benign Het
Igkv2-109 A G 6: 68,280,069 (GRCm39) T97A possibly damaging Het
Ino80 G T 2: 119,262,426 (GRCm39) Q687K probably damaging Het
Kdm4d T C 9: 14,375,409 (GRCm39) N150D probably damaging Het
Klf4 A G 4: 55,530,481 (GRCm39) I210T possibly damaging Het
Klkb1 C A 8: 45,723,734 (GRCm39) Q560H probably benign Het
Lce1a2 A T 3: 92,576,442 (GRCm39) V40E unknown Het
Maob T C X: 16,582,662 (GRCm39) T400A probably benign Het
Mipol1 C T 12: 57,543,285 (GRCm39) T393I probably benign Het
Mst1 A G 9: 107,959,446 (GRCm39) D244G probably damaging Het
Nexn G A 3: 151,949,525 (GRCm39) R258C probably damaging Het
Optc T C 1: 133,828,715 (GRCm39) probably benign Het
Or10d5 T C 9: 39,861,221 (GRCm39) N282S probably damaging Het
Or11h23 A C 14: 50,948,371 (GRCm39) I195L probably benign Het
Or6c207 A G 10: 129,104,535 (GRCm39) I219T probably damaging Het
Or7a37 A G 10: 78,806,037 (GRCm39) I185V probably benign Het
Pabpc2 C A 18: 39,908,436 (GRCm39) P567Q probably benign Het
Pierce2 T A 9: 72,887,175 (GRCm39) R111* probably null Het
Ppm1j A G 3: 104,691,990 (GRCm39) H324R possibly damaging Het
Reg3g A T 6: 78,443,544 (GRCm39) probably null Het
Sipa1l1 C T 12: 82,487,682 (GRCm39) A1652V probably benign Het
Ski T C 4: 155,243,849 (GRCm39) T554A probably benign Het
Slfn5 G A 11: 82,852,522 (GRCm39) V883M probably benign Het
Stradb T C 1: 59,030,333 (GRCm39) probably benign Het
Tex19.1 A G 11: 121,038,625 (GRCm39) T328A probably benign Het
Tpsab1 T C 17: 25,564,373 (GRCm39) N27S possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn A T 2: 76,643,244 (GRCm39) L13225Q probably damaging Het
Vmn1r28 A G 6: 58,242,843 (GRCm39) T229A probably benign Het
Wapl A G 14: 34,446,711 (GRCm39) K600E probably damaging Het
Zfp217 T C 2: 169,955,978 (GRCm39) probably null Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110,601,395 (GRCm39) splice site probably benign
IGL01066:Ano3 APN 2 110,491,790 (GRCm39) missense probably null 0.00
IGL01696:Ano3 APN 2 110,498,082 (GRCm39) missense probably damaging 1.00
IGL01729:Ano3 APN 2 110,611,739 (GRCm39) splice site probably null
IGL01785:Ano3 APN 2 110,513,060 (GRCm39) missense probably damaging 1.00
IGL01786:Ano3 APN 2 110,513,060 (GRCm39) missense probably damaging 1.00
IGL01992:Ano3 APN 2 110,488,564 (GRCm39) missense probably damaging 1.00
IGL02098:Ano3 APN 2 110,496,786 (GRCm39) nonsense probably null
IGL02333:Ano3 APN 2 110,527,544 (GRCm39) splice site probably benign
IGL02346:Ano3 APN 2 110,601,271 (GRCm39) splice site probably benign
IGL02352:Ano3 APN 2 110,715,288 (GRCm39) nonsense probably null
IGL02359:Ano3 APN 2 110,715,288 (GRCm39) nonsense probably null
IGL02544:Ano3 APN 2 110,488,594 (GRCm39) missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110,496,329 (GRCm39) splice site probably benign
IGL02861:Ano3 APN 2 110,569,157 (GRCm39) missense probably damaging 1.00
IGL02948:Ano3 APN 2 110,527,363 (GRCm39) splice site probably benign
IGL03327:Ano3 APN 2 110,527,523 (GRCm39) missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110,527,469 (GRCm39) missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110,605,355 (GRCm39) missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110,527,763 (GRCm39) missense probably damaging 1.00
R0349:Ano3 UTSW 2 110,491,832 (GRCm39) missense probably damaging 1.00
R0426:Ano3 UTSW 2 110,491,519 (GRCm39) missense probably damaging 1.00
R0523:Ano3 UTSW 2 110,715,200 (GRCm39) missense probably benign 0.13
R0557:Ano3 UTSW 2 110,693,297 (GRCm39) splice site probably null
R0611:Ano3 UTSW 2 110,715,346 (GRCm39) missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110,528,321 (GRCm39) missense probably benign 0.03
R1459:Ano3 UTSW 2 110,711,174 (GRCm39) missense probably benign 0.00
R1460:Ano3 UTSW 2 110,513,103 (GRCm39) missense probably damaging 0.97
R1773:Ano3 UTSW 2 110,591,800 (GRCm39) missense probably damaging 1.00
R1874:Ano3 UTSW 2 110,715,217 (GRCm39) missense probably benign 0.00
R1919:Ano3 UTSW 2 110,715,352 (GRCm39) missense probably benign
R2185:Ano3 UTSW 2 110,605,390 (GRCm39) missense probably benign 0.01
R2280:Ano3 UTSW 2 110,513,104 (GRCm39) missense probably benign 0.22
R2281:Ano3 UTSW 2 110,513,104 (GRCm39) missense probably benign 0.22
R2348:Ano3 UTSW 2 110,614,088 (GRCm39) missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110,693,188 (GRCm39) missense probably benign
R2697:Ano3 UTSW 2 110,625,305 (GRCm39) missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110,715,345 (GRCm39) missense probably damaging 0.99
R3923:Ano3 UTSW 2 110,601,304 (GRCm39) missense probably damaging 1.00
R4352:Ano3 UTSW 2 110,576,239 (GRCm39) missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110,591,923 (GRCm39) splice site probably null
R4790:Ano3 UTSW 2 110,715,264 (GRCm39) missense probably benign
R4832:Ano3 UTSW 2 110,498,067 (GRCm39) missense probably damaging 1.00
R4916:Ano3 UTSW 2 110,601,365 (GRCm39) missense possibly damaging 0.74
R5486:Ano3 UTSW 2 110,576,215 (GRCm39) missense probably damaging 1.00
R5498:Ano3 UTSW 2 110,527,448 (GRCm39) missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110,715,340 (GRCm39) missense probably damaging 0.99
R5627:Ano3 UTSW 2 110,587,298 (GRCm39) missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110,488,618 (GRCm39) missense probably benign 0.11
R5767:Ano3 UTSW 2 110,491,616 (GRCm39) missense probably damaging 1.00
R5883:Ano3 UTSW 2 110,711,209 (GRCm39) missense probably null 0.15
R5899:Ano3 UTSW 2 110,693,232 (GRCm39) missense probably benign 0.39
R5916:Ano3 UTSW 2 110,512,181 (GRCm39) missense probably benign 0.29
R6158:Ano3 UTSW 2 110,496,220 (GRCm39) missense probably damaging 1.00
R6315:Ano3 UTSW 2 110,527,384 (GRCm39) missense probably damaging 1.00
R6401:Ano3 UTSW 2 110,605,459 (GRCm39) missense probably benign 0.01
R6481:Ano3 UTSW 2 110,625,372 (GRCm39) missense probably benign 0.16
R6482:Ano3 UTSW 2 110,527,400 (GRCm39) missense probably damaging 1.00
R6587:Ano3 UTSW 2 110,628,249 (GRCm39) splice site probably null
R6811:Ano3 UTSW 2 110,711,212 (GRCm39) missense probably benign 0.03
R7048:Ano3 UTSW 2 110,513,116 (GRCm39) nonsense probably null
R7145:Ano3 UTSW 2 110,693,205 (GRCm39) missense probably benign 0.31
R7207:Ano3 UTSW 2 110,611,768 (GRCm39) missense probably damaging 0.96
R7215:Ano3 UTSW 2 110,496,277 (GRCm39) missense probably damaging 1.00
R7366:Ano3 UTSW 2 110,587,412 (GRCm39) missense probably damaging 1.00
R7371:Ano3 UTSW 2 110,715,194 (GRCm39) critical splice donor site probably null
R7568:Ano3 UTSW 2 110,780,638 (GRCm39) start gained probably benign
R7636:Ano3 UTSW 2 110,513,048 (GRCm39) nonsense probably null
R7888:Ano3 UTSW 2 110,496,773 (GRCm39) missense probably damaging 1.00
R7992:Ano3 UTSW 2 110,605,367 (GRCm39) missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110,498,128 (GRCm39) missense probably damaging 0.99
R8074:Ano3 UTSW 2 110,780,577 (GRCm39) start gained probably benign
R8111:Ano3 UTSW 2 110,614,058 (GRCm39) missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110,496,801 (GRCm39) missense probably damaging 1.00
R8297:Ano3 UTSW 2 110,491,616 (GRCm39) missense probably damaging 1.00
R8485:Ano3 UTSW 2 110,498,200 (GRCm39) critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110,496,180 (GRCm39) missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110,614,074 (GRCm39) missense probably benign 0.12
R9071:Ano3 UTSW 2 110,625,418 (GRCm39) critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110,576,243 (GRCm39) missense probably benign 0.06
R9073:Ano3 UTSW 2 110,576,243 (GRCm39) missense probably benign 0.06
R9315:Ano3 UTSW 2 110,528,287 (GRCm39) missense probably damaging 0.97
R9376:Ano3 UTSW 2 110,496,782 (GRCm39) missense probably damaging 1.00
R9588:Ano3 UTSW 2 110,528,342 (GRCm39) missense possibly damaging 0.91
R9697:Ano3 UTSW 2 110,496,253 (GRCm39) missense probably damaging 1.00
R9716:Ano3 UTSW 2 110,601,376 (GRCm39) missense probably damaging 0.97
R9748:Ano3 UTSW 2 110,488,640 (GRCm39) missense probably damaging 1.00
RF012:Ano3 UTSW 2 110,527,868 (GRCm39) missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110,527,381 (GRCm39) missense probably benign 0.30
X0058:Ano3 UTSW 2 110,527,763 (GRCm39) missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110,576,192 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAGCAGAGCATTCTTGA -3'
(R):5'- GTTAGAACAGGAGGAACAATGGTATT -3'

Sequencing Primer
(F):5'- GGAGCAGAGCATTCTTGATTTACCC -3'
(R):5'- CTCACAGTCAGCTATTGGATGGATC -3'
Posted On 2016-06-15