Incidental Mutation 'R5113:Ino80'
ID394000
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119431945 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 687 (Q687K)
Ref Sequence ENSEMBL: ENSMUSP00000106431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
Predicted Effect probably damaging
Transcript: ENSMUST00000049920
AA Change: Q687K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: Q687K

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110808
AA Change: Q687K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: Q687K

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138707
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTTATTAGATGGGCAACATTTCC -3'
(R):5'- AGTGCTCTTAACCACTCTCCAG -3'

Sequencing Primer
(F):5'- TTAGATGGGCAACATTTCCTAATG -3'
(R):5'- CCAGCCCCAGTATATGATTCTTAAG -3'
Posted On2016-06-15