Incidental Mutation 'R5113:Vmn1r28'
ID394013
Institutional Source Beutler Lab
Gene Symbol Vmn1r28
Ensembl Gene ENSMUSG00000115705
Gene Namevomeronasal 1 receptor 28
SynonymsV1rc25
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location58262037-58275639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58265858 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 229 (T229A)
Ref Sequence ENSEMBL: ENSMUSP00000153785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176874] [ENSMUST00000226813] [ENSMUST00000227805] [ENSMUST00000228678]
Predicted Effect probably benign
Transcript: ENSMUST00000176874
AA Change: T229A

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135311
Gene: ENSMUSG00000094291
AA Change: T229A

DomainStartEndE-ValueType
Pfam:V1R 28 293 8.4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226813
AA Change: T229A

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000227805
AA Change: T229A

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000228678
AA Change: T229A

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Vmn1r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Vmn1r28 APN 6 58265191 missense possibly damaging 0.76
IGL01712:Vmn1r28 APN 6 58265408 missense probably benign 0.00
IGL01788:Vmn1r28 APN 6 58265537 missense probably benign 0.00
IGL02629:Vmn1r28 APN 6 58265816 missense probably benign 0.00
R0001:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0009:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0040:Vmn1r28 UTSW 6 58265894 missense probably damaging 1.00
R0078:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0079:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0081:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0164:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0164:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0165:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0166:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0167:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0172:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0173:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0284:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0288:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0704:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R1143:Vmn1r28 UTSW 6 58265742 missense probably benign 0.00
R1225:Vmn1r28 UTSW 6 58265966 nonsense probably null
R1464:Vmn1r28 UTSW 6 58265232 missense probably benign 0.05
R1464:Vmn1r28 UTSW 6 58265232 missense probably benign 0.05
R1836:Vmn1r28 UTSW 6 58265252 missense probably damaging 0.98
R1882:Vmn1r28 UTSW 6 58265978 missense probably benign
R1905:Vmn1r28 UTSW 6 58265927 missense probably benign 0.01
R4912:Vmn1r28 UTSW 6 58265540 missense possibly damaging 0.86
R5071:Vmn1r28 UTSW 6 58265909 missense probably benign 0.25
R5261:Vmn1r28 UTSW 6 58265539 missense probably benign 0.02
R5265:Vmn1r28 UTSW 6 58265964 missense probably damaging 0.98
R5839:Vmn1r28 UTSW 6 58265295 missense possibly damaging 0.94
R6180:Vmn1r28 UTSW 6 58265491 missense probably damaging 0.99
R6643:Vmn1r28 UTSW 6 58265960 missense probably benign 0.17
R6884:Vmn1r28 UTSW 6 58265648 missense probably benign 0.03
R7393:Vmn1r28 UTSW 6 58265589 missense possibly damaging 0.81
R7471:Vmn1r28 UTSW 6 58265865 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACTACATCATCAGGGGATCG -3'
(R):5'- AAATCTGGTGGAACTTGGAGTG -3'

Sequencing Primer
(F):5'- CATCAGGGGATCGATTTTAACAGTG -3'
(R):5'- AACTTGGAGTGCATGTTTTTCAG -3'
Posted On2016-06-15