Mutagenetix > Incidental Mutation

Incidental Mutation 'R5113:Grik5'

394017

Institutional Source

Beutler Lab

Gene Symbol

Grik5

Ensembl Gene

ENSMUSG00000003378

Gene Name

glutamate receptor, ionotropic, kainate 5 (gamma 2)

Synonyms

GluRgamma2, KA2

MMRRC Submission

042701-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R5113 (G1)

Quality Score

197

Status

Not validated

Chromosome

Chromosomal Location

25009849-25072346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25015527 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 681 (S681P)

Ref Sequence

ENSEMBL: ENSMUSP00000003468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]

AlphaFold

Q61626

Predicted Effect

probably damaging
Transcript: ENSMUST00000003468
AA Change: S681P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: S681P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	40	381	3.4e-64	PFAM
PBPe	416	785	3.7e-122	SMART
Lig_chan-Glu_bd	426	490	1.65e-29	SMART
transmembrane domain	804	823	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
low complexity region	893	921	N/A	INTRINSIC
low complexity region	962	973	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205328

Predicted Effect

probably benign
Transcript: ENSMUST00000206134

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox12e	A	G	11: 70,315,995	V622A	possibly damaging	Het
Ankef1	A	G	2: 136,552,441	N590S	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano3	A	T	2: 110,661,480	N867K	possibly damaging	Het
Ash1l	T	C	3: 89,066,275	V2547A	probably damaging	Het
Ccpg1os	T	A	9: 72,979,893	R111*	probably null	Het
Chil5	A	T	3: 106,017,978	V209E	possibly damaging	Het
Cltc	A	T	11: 86,722,321	C459S	probably damaging	Het
Col6a4	T	A	9: 106,066,960	D1105V	possibly damaging	Het
Cyp2c66	A	G	19: 39,163,438	D199G	probably benign	Het
Cyp4f18	A	G	8: 71,989,058		probably null	Het
Cysrt1	A	T	2: 25,239,351	C50S	possibly damaging	Het
Dapk1	A	G	13: 60,721,778	K278R	probably benign	Het
Eefsec	C	A	6: 88,281,575	S512I	probably damaging	Het
Emilin1	T	C	5: 30,920,620	F908L	possibly damaging	Het
Eml1	T	C	12: 108,537,337	V731A	possibly damaging	Het
Erc2	T	C	14: 27,652,872	S16P	probably benign	Het
Gfpt2	A	G	11: 49,823,799	R342G	probably damaging	Het
Gpr142	A	T	11: 114,804,317	Q36L	probably benign	Het
Hecw1	A	T	13: 14,346,029	S208T	possibly damaging	Het
Hmgcr	G	A	13: 96,656,732	A464V	probably benign	Het
Igkv2-109	A	G	6: 68,303,085	T97A	possibly damaging	Het
Ino80	G	T	2: 119,431,945	Q687K	probably damaging	Het
Kdm4d	T	C	9: 14,464,113	N150D	probably damaging	Het
Klf4	A	G	4: 55,530,481	I210T	possibly damaging	Het
Klkb1	C	A	8: 45,270,697	Q560H	probably benign	Het
Lce1a2	A	T	3: 92,669,135	V40E	unknown	Het
Maob	T	C	X: 16,716,423	T400A	probably benign	Het
Mipol1	C	T	12: 57,496,499	T393I	probably benign	Het
Mst1	A	G	9: 108,082,247	D244G	probably damaging	Het
Nexn	G	A	3: 152,243,888	R258C	probably damaging	Het
Olfr1353	A	G	10: 78,970,203	I185V	probably benign	Het
Olfr748	A	C	14: 50,710,914	I195L	probably benign	Het
Olfr777	A	G	10: 129,268,666	I219T	probably damaging	Het
Olfr975	T	C	9: 39,949,925	N282S	probably damaging	Het
Optc	T	C	1: 133,900,977		probably benign	Het
Pabpc2	C	A	18: 39,775,383	P567Q	probably benign	Het
Ppm1j	A	G	3: 104,784,674	H324R	possibly damaging	Het
Reg3g	A	T	6: 78,466,561		probably null	Het
Sipa1l1	C	T	12: 82,440,908	A1652V	probably benign	Het
Ski	T	C	4: 155,159,392	T554A	probably benign	Het
Slfn5	G	A	11: 82,961,696	V883M	probably benign	Het
Stradb	T	C	1: 58,991,174		probably benign	Het
Tex19.1	A	G	11: 121,147,799	T328A	probably benign	Het
Tpsab1	T	C	17: 25,345,399	N27S	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttn	A	T	2: 76,812,900	L13225Q	probably damaging	Het
Vmn1r28	A	G	6: 58,265,858	T229A	probably benign	Het
Wapl	A	G	14: 34,724,754	K600E	probably damaging	Het
Zfp217	T	C	2: 170,114,058		probably null	Het

Other mutations in Grik5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Grik5	APN	7	25065393	missense	probably damaging	1.00
IGL00974:Grik5	APN	7	25013885	missense	probably damaging	1.00
IGL01941:Grik5	APN	7	25065182	missense	probably damaging	1.00
IGL02642:Grik5	APN	7	25058983	missense	possibly damaging	0.51
IGL03177:Grik5	APN	7	25015454	missense	probably damaging	1.00
IGL03402:Grik5	APN	7	25015469	missense	probably damaging	1.00
Griffin	UTSW	7	25059077	missense	possibly damaging	0.78
G1citation:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
PIT4453001:Grik5	UTSW	7	25010694	missense	probably damaging	0.99
R0077:Grik5	UTSW	7	25023380	missense	probably damaging	1.00
R0412:Grik5	UTSW	7	25013674	missense	possibly damaging	0.59
R0427:Grik5	UTSW	7	25058498	missense	probably benign	0.34
R1191:Grik5	UTSW	7	25058325	nonsense	probably null
R1830:Grik5	UTSW	7	25046301	missense	possibly damaging	0.94
R2072:Grik5	UTSW	7	25015313	missense	possibly damaging	0.92
R2369:Grik5	UTSW	7	25058537	missense	probably damaging	1.00
R3410:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3411:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3615:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R3616:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R4600:Grik5	UTSW	7	25068064	missense	probably damaging	0.99
R4658:Grik5	UTSW	7	25060727	splice site	probably benign
R4735:Grik5	UTSW	7	25058288	missense	probably damaging	1.00
R4810:Grik5	UTSW	7	25015497	missense	probably damaging	0.98
R5120:Grik5	UTSW	7	25010640	missense	probably damaging	1.00
R5132:Grik5	UTSW	7	25065204	missense	probably benign	0.02
R5173:Grik5	UTSW	7	25062894	missense	possibly damaging	0.76
R5186:Grik5	UTSW	7	25015819	missense	probably damaging	1.00
R5239:Grik5	UTSW	7	25065470	missense	probably damaging	1.00
R5935:Grik5	UTSW	7	25059077	missense	possibly damaging	0.78
R6335:Grik5	UTSW	7	25013594	missense	probably benign
R6609:Grik5	UTSW	7	25015526	nonsense	probably null
R6760:Grik5	UTSW	7	25058939	critical splice donor site	probably null
R6820:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6821:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6822:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6824:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R7173:Grik5	UTSW	7	25068162	missense	probably damaging	1.00
R7230:Grik5	UTSW	7	25023070	missense	probably damaging	1.00
R7555:Grik5	UTSW	7	25060597	missense	probably benign
R7560:Grik5	UTSW	7	25058526	missense	probably damaging	0.99
R7571:Grik5	UTSW	7	25013885	missense	possibly damaging	0.87
R8228:Grik5	UTSW	7	25010508	missense	probably damaging	1.00
R8228:Grik5	UTSW	7	25046310	missense	possibly damaging	0.93
R8681:Grik5	UTSW	7	25010472	missense	probably benign	0.06
R8879:Grik5	UTSW	7	25023064	missense	possibly damaging	0.95
R8933:Grik5	UTSW	7	25023318	missense	probably benign	0.11
R9129:Grik5	UTSW	7	25068004	splice site	probably benign
R9130:Grik5	UTSW	7	25068004	splice site	probably benign
R9154:Grik5	UTSW	7	25058978	missense	probably damaging	1.00
R9317:Grik5	UTSW	7	25046235	missense	probably damaging	0.99
R9355:Grik5	UTSW	7	25068172	missense	possibly damaging	0.82
R9406:Grik5	UTSW	7	25058544	missense	probably benign	0.00
X0017:Grik5	UTSW	7	25060588	missense	probably damaging	1.00
Z1176:Grik5	UTSW	7	25013804	missense	probably damaging	0.98
Z1177:Grik5	UTSW	7	25015825	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGTTGCAATTGAGGCGC -3'
(R):5'- AGTAGACATCCTTGACCTGTCC -3'

Sequencing Primer
(F):5'- CAATTGAGGCGCCTGTGGTAC -3'
(R):5'- CCTGGTGAATGGGATCCAATGC -3'

Posted On

2016-06-15