Incidental Mutation 'R5113:Klkb1'
ID394019
Institutional Source Beutler Lab
Gene Symbol Klkb1
Ensembl Gene ENSMUSG00000109764
Gene Namekallikrein B, plasma 1
SynonymsKlk3, Kal-3, PSA, Kal3
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45266689-45294859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45270697 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 560 (Q560H)
Ref Sequence ENSEMBL: ENSMUSP00000026907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026907]
Predicted Effect probably benign
Transcript: ENSMUST00000026907
AA Change: Q560H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026907
Gene: ENSMUSG00000109764
AA Change: Q560H

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116473
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric enzyme comprised of heavy and light chains. A complete deletion of the encoded protein prevents occlusive thrombus formation in mice with a minimal role in provoked bleeding. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced hematoma expansion in streptozotocin-induced diabetic mice subjected to autologous blood injection, and prolonged activated partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Klkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Klkb1 APN 8 45294068 splice site probably benign
IGL01756:Klkb1 APN 8 45272324 missense probably damaging 0.99
IGL01783:Klkb1 APN 8 45276391 missense probably damaging 1.00
IGL01809:Klkb1 APN 8 45276053 missense probably benign 0.00
IGL02128:Klkb1 APN 8 45287031 missense probably damaging 1.00
IGL02512:Klkb1 APN 8 45276240 splice site probably benign
E0374:Klkb1 UTSW 8 45289091 missense possibly damaging 0.58
R0048:Klkb1 UTSW 8 45289196 splice site probably benign
R0149:Klkb1 UTSW 8 45276063 missense probably damaging 1.00
R0278:Klkb1 UTSW 8 45272409 missense probably benign 0.27
R0551:Klkb1 UTSW 8 45277966 critical splice donor site probably null
R1103:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1420:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1930:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R1931:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R2125:Klkb1 UTSW 8 45275504 missense possibly damaging 0.68
R2418:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R2419:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R3938:Klkb1 UTSW 8 45282801 missense probably damaging 0.99
R4445:Klkb1 UTSW 8 45277055 missense probably benign 0.11
R4461:Klkb1 UTSW 8 45273575 missense probably damaging 1.00
R4969:Klkb1 UTSW 8 45282777 missense probably benign 0.43
R4974:Klkb1 UTSW 8 45286958 missense probably damaging 1.00
R5117:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R5339:Klkb1 UTSW 8 45270711 missense possibly damaging 0.93
R5891:Klkb1 UTSW 8 45270666 missense probably benign 0.13
R6230:Klkb1 UTSW 8 45283215 missense probably benign 0.03
R6554:Klkb1 UTSW 8 45273554 missense probably damaging 1.00
R6564:Klkb1 UTSW 8 45273634 missense probably damaging 0.98
R7130:Klkb1 UTSW 8 45275538 missense probably benign 0.00
R7497:Klkb1 UTSW 8 45294790 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTATCGTTTCAAATAGCCTTC -3'
(R):5'- CGAGTCTGAAATATGTCACTAGAAGG -3'

Sequencing Primer
(F):5'- GCCTTCAAATCGTTTAACTCTGGAAC -3'
(R):5'- AGGCAGCACGGATCACTG -3'
Posted On2016-06-15