Incidental Mutation 'R5113:Slfn5'
ID 394030
Institutional Source Beutler Lab
Gene Symbol Slfn5
Ensembl Gene ENSMUSG00000054404
Gene Name schlafen 5
Synonyms
MMRRC Submission 042701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R5113 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 82951349-82964840 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 82961696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 883 (V883M)
Ref Sequence ENSEMBL: ENSMUSP00000103792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067443] [ENSMUST00000108157] [ENSMUST00000108158]
AlphaFold Q8CBA2
Predicted Effect probably benign
Transcript: ENSMUST00000067443
AA Change: V883M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000064819
Gene: ENSMUSG00000054404
AA Change: V883M

DomainStartEndE-ValueType
Pfam:AlbA_2 187 319 4.7e-13 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 743 4.7e-8 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108157
AA Change: V883M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103792
Gene: ENSMUSG00000054404
AA Change: V883M

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 1.9e-15 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 739 9.4e-9 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108158
SMART Domains Protein: ENSMUSP00000103793
Gene: ENSMUSG00000054404

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216469
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Slfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Slfn5 APN 11 82956981 missense probably damaging 0.97
IGL01773:Slfn5 APN 11 82961331 missense probably damaging 1.00
IGL03026:Slfn5 APN 11 82956561 missense probably benign
IGL03368:Slfn5 APN 11 82956385 missense possibly damaging 0.88
R0531:Slfn5 UTSW 11 82961040 missense probably damaging 0.99
R0690:Slfn5 UTSW 11 82961403 missense probably damaging 1.00
R0939:Slfn5 UTSW 11 82961338 missense probably benign 0.04
R1005:Slfn5 UTSW 11 82960158 missense probably damaging 1.00
R1214:Slfn5 UTSW 11 82960091 missense probably benign 0.01
R1978:Slfn5 UTSW 11 82956616 missense probably benign 0.17
R4092:Slfn5 UTSW 11 82961067 missense probably damaging 1.00
R4620:Slfn5 UTSW 11 82961652 missense probably damaging 1.00
R4789:Slfn5 UTSW 11 82956400 missense probably benign 0.00
R5120:Slfn5 UTSW 11 82960928 missense probably damaging 1.00
R5262:Slfn5 UTSW 11 82956670 missense possibly damaging 0.56
R5307:Slfn5 UTSW 11 82956385 missense probably damaging 0.96
R5451:Slfn5 UTSW 11 82960086 missense probably damaging 1.00
R5498:Slfn5 UTSW 11 82957147 missense possibly damaging 0.84
R5651:Slfn5 UTSW 11 82960664 missense probably benign 0.00
R5777:Slfn5 UTSW 11 82961004 missense probably damaging 0.99
R5906:Slfn5 UTSW 11 82957276 missense probably benign 0.37
R5934:Slfn5 UTSW 11 82956592 missense probably damaging 1.00
R6521:Slfn5 UTSW 11 82960415 missense probably damaging 0.99
R6543:Slfn5 UTSW 11 82958666 splice site probably null
R6681:Slfn5 UTSW 11 82956378 missense possibly damaging 0.73
R7129:Slfn5 UTSW 11 82961150 nonsense probably null
R7309:Slfn5 UTSW 11 82956703 missense probably damaging 1.00
R7478:Slfn5 UTSW 11 82960616 missense probably damaging 1.00
R7573:Slfn5 UTSW 11 82958759 missense probably damaging 1.00
R7610:Slfn5 UTSW 11 82961484 missense probably damaging 1.00
R7834:Slfn5 UTSW 11 82960452 missense possibly damaging 0.88
R7957:Slfn5 UTSW 11 82956787 missense probably benign 0.00
R8205:Slfn5 UTSW 11 82960718 missense probably benign 0.04
R8264:Slfn5 UTSW 11 82956550 missense probably damaging 1.00
R8982:Slfn5 UTSW 11 82960140 nonsense probably null
R9130:Slfn5 UTSW 11 82960620 missense probably damaging 1.00
R9135:Slfn5 UTSW 11 82960677 missense probably benign 0.00
R9209:Slfn5 UTSW 11 82960107 missense possibly damaging 0.94
R9454:Slfn5 UTSW 11 82960059 missense probably benign 0.03
R9534:Slfn5 UTSW 11 82958697 missense probably benign 0.01
R9565:Slfn5 UTSW 11 82956873 missense possibly damaging 0.94
R9608:Slfn5 UTSW 11 82961004 missense possibly damaging 0.92
R9608:Slfn5 UTSW 11 82961495 missense probably benign 0.05
R9686:Slfn5 UTSW 11 82957175 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGAGCCCAGTTTACTAGTGCAG -3'
(R):5'- TATCTCAGTGCCAGCTAATTGC -3'

Sequencing Primer
(F):5'- CCCAGTTTACTAGTGCAGGTCAG -3'
(R):5'- AATTGCTCTGCTGTCTCTTCCTACTG -3'
Posted On 2016-06-15