Incidental Mutation 'R5113:Gpr142'
ID394032
Institutional Source Beutler Lab
Gene Symbol Gpr142
Ensembl Gene ENSMUSG00000034677
Gene NameG protein-coupled receptor 142
Synonyms
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location114798924-114806745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114804317 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 36 (Q36L)
Ref Sequence ENSEMBL: ENSMUSP00000102194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045319] [ENSMUST00000106584]
Predicted Effect probably benign
Transcript: ENSMUST00000045319
AA Change: Q36L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045029
Gene: ENSMUSG00000034677
AA Change: Q36L

DomainStartEndE-ValueType
Pfam:7tm_1 84 321 4.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106584
AA Change: Q36L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102194
Gene: ENSMUSG00000034677
AA Change: Q36L

DomainStartEndE-ValueType
Pfam:7tm_1 86 327 2.7e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GPR142 is a member of the rhodopsin family of G protein-coupled receptors (GPRs) (Fredriksson et al., 2003 [PubMed 14623098]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Gpr142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Gpr142 APN 11 114804326 missense probably damaging 0.99
IGL02325:Gpr142 APN 11 114806121 missense probably damaging 1.00
R0054:Gpr142 UTSW 11 114798929 missense probably benign
R0054:Gpr142 UTSW 11 114798929 missense probably benign
R0403:Gpr142 UTSW 11 114806029 missense probably damaging 0.99
R0433:Gpr142 UTSW 11 114805997 missense probably damaging 1.00
R1299:Gpr142 UTSW 11 114804359 missense probably benign 0.01
R5022:Gpr142 UTSW 11 114804388 missense probably benign 0.17
R5261:Gpr142 UTSW 11 114804342 missense probably damaging 0.97
R5895:Gpr142 UTSW 11 114798959 nonsense probably null
R6041:Gpr142 UTSW 11 114806377 missense probably damaging 1.00
R7679:Gpr142 UTSW 11 114806707 missense possibly damaging 0.48
R8062:Gpr142 UTSW 11 114806531 missense probably benign 0.05
X0017:Gpr142 UTSW 11 114805918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTAGGGACTGCATTTGTC -3'
(R):5'- ATGGATCCTCTGTGATTTCGC -3'

Sequencing Primer
(F):5'- CTGGGTCTGTCCTAGGGCTC -3'
(R):5'- GAATGGCTGATGGATAGCCCTAATTC -3'
Posted On2016-06-15