Incidental Mutation 'R5113:Mipol1'
ID 394034
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5113 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 57496499 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 393 (T393I)
Ref Sequence ENSEMBL: ENSMUSP00000119918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000123498
AA Change: T393I

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: T393I

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130447
AA Change: T393I

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: T393I

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57325581 missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8861:Mipol1 UTSW 12 57306016 missense probably benign 0.00
R8928:Mipol1 UTSW 12 57460865 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9250:Mipol1 UTSW 12 57414383 missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACAGTAACGCTTTGTCTCTTAG -3'
(R):5'- AATAACTGTAGTCAGCAGCAAAGTG -3'

Sequencing Primer
(F):5'- CTTAGCATGACTACCGGTATGGC -3'
(R):5'- CAGCAGCAAAGTGGTTAAACATTTG -3'
Posted On 2016-06-15