Mutagenetix > Incidental Mutations

Incidental Mutation 'R5113:Mipol1'

394034

Institutional Source

Beutler Lab

Gene Symbol

Mipol1

Ensembl Gene

ENSMUSG00000047022

Gene Name

mirror-image polydactyly 1

Synonyms

1700081O04Rik, 6030439O22Rik, D12Ertd19e

MMRRC Submission

042701-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57230427-57497199 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 57496499 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 393 (T393I)

Ref Sequence

ENSEMBL: ENSMUSP00000119918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000123498
AA Change: T393I

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: T393I

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000130447
AA Change: T393I

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: T393I

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox12e	A	G	11: 70,315,995	V622A	possibly damaging	Het
Ankef1	A	G	2: 136,552,441	N590S	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano3	A	T	2: 110,661,480	N867K	possibly damaging	Het
Ash1l	T	C	3: 89,066,275	V2547A	probably damaging	Het
Ccpg1os	T	A	9: 72,979,893	R111*	probably null	Het
Chil5	A	T	3: 106,017,978	V209E	possibly damaging	Het
Cltc	A	T	11: 86,722,321	C459S	probably damaging	Het
Col6a4	T	A	9: 106,066,960	D1105V	possibly damaging	Het
Cyp2c66	A	G	19: 39,163,438	D199G	probably benign	Het
Cyp4f18	A	G	8: 71,989,058		probably null	Het
Cysrt1	A	T	2: 25,239,351	C50S	possibly damaging	Het
Dapk1	A	G	13: 60,721,778	K278R	probably benign	Het
Eefsec	C	A	6: 88,281,575	S512I	probably damaging	Het
Emilin1	T	C	5: 30,920,620	F908L	possibly damaging	Het
Eml1	T	C	12: 108,537,337	V731A	possibly damaging	Het
Erc2	T	C	14: 27,652,872	S16P	probably benign	Het
Gfpt2	A	G	11: 49,823,799	R342G	probably damaging	Het
Gpr142	A	T	11: 114,804,317	Q36L	probably benign	Het
Grik5	A	G	7: 25,015,527	S681P	probably damaging	Het
Hecw1	A	T	13: 14,346,029	S208T	possibly damaging	Het
Hmgcr	G	A	13: 96,656,732	A464V	probably benign	Het
Igkv2-109	A	G	6: 68,303,085	T97A	possibly damaging	Het
Ino80	G	T	2: 119,431,945	Q687K	probably damaging	Het
Kdm4d	T	C	9: 14,464,113	N150D	probably damaging	Het
Klf4	A	G	4: 55,530,481	I210T	possibly damaging	Het
Klkb1	C	A	8: 45,270,697	Q560H	probably benign	Het
Lce1a2	A	T	3: 92,669,135	V40E	unknown	Het
Maob	T	C	X: 16,716,423	T400A	probably benign	Het
Mst1	A	G	9: 108,082,247	D244G	probably damaging	Het
Nexn	G	A	3: 152,243,888	R258C	probably damaging	Het
Olfr1353	A	G	10: 78,970,203	I185V	probably benign	Het
Olfr748	A	C	14: 50,710,914	I195L	probably benign	Het
Olfr777	A	G	10: 129,268,666	I219T	probably damaging	Het
Olfr975	T	C	9: 39,949,925	N282S	probably damaging	Het
Optc	T	C	1: 133,900,977		probably benign	Het
Pabpc2	C	A	18: 39,775,383	P567Q	probably benign	Het
Ppm1j	A	G	3: 104,784,674	H324R	possibly damaging	Het
Reg3g	A	T	6: 78,466,561		probably null	Het
Sipa1l1	C	T	12: 82,440,908	A1652V	probably benign	Het
Ski	T	C	4: 155,159,392	T554A	probably benign	Het
Slfn5	G	A	11: 82,961,696	V883M	probably benign	Het
Stradb	T	C	1: 58,991,174		probably benign	Het
Tex19.1	A	G	11: 121,147,799	T328A	probably benign	Het
Tpsab1	T	C	17: 25,345,399	N27S	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttn	A	T	2: 76,812,900	L13225Q	probably damaging	Het
Vmn1r28	A	G	6: 58,265,858	T229A	probably benign	Het
Wapl	A	G	14: 34,724,754	K600E	probably damaging	Het
Zfp217	T	C	2: 170,114,058		probably null	Het

Other mutations in Mipol1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Mipol1	APN	12	57307353	splice site	probably benign
IGL01139:Mipol1	APN	12	57306035	nonsense	probably null
IGL02679:Mipol1	APN	12	57306043	missense	possibly damaging	0.84
IGL03109:Mipol1	APN	12	57364224	missense	probably benign	0.20
R0001:Mipol1	UTSW	12	57460839	splice site	probably benign
R0220:Mipol1	UTSW	12	57457150	missense	probably damaging	1.00
R0271:Mipol1	UTSW	12	57460954	unclassified	probably benign
R0284:Mipol1	UTSW	12	57457069	missense	probably damaging	0.98
R0496:Mipol1	UTSW	12	57457177	missense	probably damaging	0.99
R0538:Mipol1	UTSW	12	57414411	critical splice donor site	probably null
R1082:Mipol1	UTSW	12	57325616	missense	probably damaging	0.98
R1552:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R1558:Mipol1	UTSW	12	57332341	missense	probably damaging	1.00
R1928:Mipol1	UTSW	12	57332419	missense	probably damaging	1.00
R2104:Mipol1	UTSW	12	57306056	splice site	probably null
R2495:Mipol1	UTSW	12	57460990	splice site	probably benign
R3723:Mipol1	UTSW	12	57457092	missense	probably damaging	1.00
R4431:Mipol1	UTSW	12	57303524	missense	possibly damaging	0.58
R4447:Mipol1	UTSW	12	57352748	intron	probably benign
R4654:Mipol1	UTSW	12	57306132	missense	probably benign	0.22
R4847:Mipol1	UTSW	12	57303496	missense	probably damaging	0.99
R4851:Mipol1	UTSW	12	57332301	missense	probably damaging	1.00
R5668:Mipol1	UTSW	12	57325560	missense	possibly damaging	0.48
R6535:Mipol1	UTSW	12	57306100	missense	possibly damaging	0.95
R7172:Mipol1	UTSW	12	57325535	missense	possibly damaging	0.95
R7191:Mipol1	UTSW	12	57457066	missense	probably benign	0.01
R7560:Mipol1	UTSW	12	57306073	missense	possibly damaging	0.94
R8508:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R8752:Mipol1	UTSW	12	57325581	missense	probably damaging	1.00
R8772:Mipol1	UTSW	12	57325632	missense	probably benign	0.23
R8861:Mipol1	UTSW	12	57306016	missense	probably benign	0.00
R8928:Mipol1	UTSW	12	57460865	missense	probably benign	0.00
R9011:Mipol1	UTSW	12	57457079	missense	probably benign	0.03
R9250:Mipol1	UTSW	12	57414383	missense	probably damaging	1.00
R9383:Mipol1	UTSW	12	57306034	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCACAGTAACGCTTTGTCTCTTAG -3'
(R):5'- AATAACTGTAGTCAGCAGCAAAGTG -3'

Sequencing Primer
(F):5'- CTTAGCATGACTACCGGTATGGC -3'
(R):5'- CAGCAGCAAAGTGGTTAAACATTTG -3'

Posted On

2016-06-15