Mutagenetix > Incidental Mutation

Incidental Mutation 'R0446:Pdzd2'

39404

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

038647-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R0446 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12375024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1675 (V1675E)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075317
AA Change: V1675E

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: V1675E

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	G	A	2: 91,304,764	T20I	possibly damaging	Het
4930435E12Rik	G	A	16: 38,828,702	T15I	probably benign	Het
4933434E20Rik	A	G	3: 90,064,459	T42A	probably benign	Het
Actr3b	T	A	5: 25,831,732	I181K	probably damaging	Het
Avl9	G	T	6: 56,736,483	R242L	probably benign	Het
B3galt4	T	C	17: 33,951,018	E82G	probably benign	Het
Bag1	G	A	4: 40,936,609	T349I	probably benign	Het
Brip1	A	T	11: 86,157,601	L305Q	probably damaging	Het
Cdipt	A	G	7: 126,978,264	T61A	probably damaging	Het
Cmya5	T	A	13: 93,093,656	R1641S	probably benign	Het
Cog7	T	C	7: 121,937,072	D515G	probably benign	Het
Cpsf4	T	A	5: 145,177,244	L171Q	probably damaging	Het
Cuzd1	A	T	7: 131,316,280		probably null	Het
Dapk1	T	A	13: 60,725,287		probably null	Het
Diaph1	A	G	18: 37,853,590	V1114A	possibly damaging	Het
Emx2	A	T	19: 59,463,916	K211*	probably null	Het
Fam160b1	G	A	19: 57,381,407	D461N	probably benign	Het
Fam170a	T	A	18: 50,280,632	C55S	possibly damaging	Het
Fbxw26	A	G	9: 109,743,720	S119P	probably benign	Het
Fryl	G	A	5: 73,097,417	T894M	possibly damaging	Het
Gad1-ps	C	A	10: 99,445,521		noncoding transcript	Het
Gm14124	A	G	2: 150,268,073	T228A	possibly damaging	Het
Gss	T	C	2: 155,567,745	E257G	probably benign	Het
Klhdc1	A	C	12: 69,283,308	S404R	probably benign	Het
Kmt2e	T	A	5: 23,497,534		probably null	Het
Krt20	G	A	11: 99,437,776	Q108*	probably null	Het
Lmnb1	T	A	18: 56,743,259	S480T	probably benign	Het
Lyst	T	A	13: 13,638,048	M1015K	probably benign	Het
Mdm1	T	G	10: 118,152,056	S290A	probably benign	Het
Mkln1	T	A	6: 31,449,504	F238I	probably damaging	Het
Mrgprb3	A	G	7: 48,643,236	V189A	probably benign	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Neurod6	C	T	6: 55,679,629	E8K	probably benign	Het
Nlrp12	T	C	7: 3,234,029	I747V	probably benign	Het
Notch4	C	T	17: 34,565,363	R43W	possibly damaging	Het
Obscn	A	T	11: 58,995,412		probably benign	Het
Olfr1153	T	C	2: 87,896,855	Y219H	possibly damaging	Het
Olfr1346	T	C	7: 6,475,025	V305A	probably benign	Het
Olfr480	A	T	7: 108,066,725	Y24*	probably null	Het
Olfr522	A	T	7: 140,162,471	S160T	probably damaging	Het
Olfr920	G	T	9: 38,755,818	L43F	probably damaging	Het
Olfr958	A	T	9: 39,550,451	I140N	probably damaging	Het
Orc5	C	T	5: 22,546,457	V85I	probably benign	Het
Pccb	T	C	9: 100,982,797	D468G	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pltp	A	T	2: 164,854,400	N97K	probably damaging	Het
Polr1a	T	C	6: 71,950,664		probably null	Het
Prss42	G	A	9: 110,799,273	V162I	possibly damaging	Het
Rbfox2	A	T	15: 77,099,255	Y269N	probably damaging	Het
Rftn2	A	T	1: 55,214,195	I83K	probably damaging	Het
S1pr4	A	T	10: 81,498,989	I217N	probably damaging	Het
Slc23a2	T	C	2: 132,078,433	K184R	probably benign	Het
Slc6a19	T	C	13: 73,691,695	N156S	probably benign	Het
Svep1	C	T	4: 58,088,280	G1723D	probably damaging	Het
Tbc1d32	T	A	10: 56,192,898	H358L	possibly damaging	Het
Tigit	G	T	16: 43,662,271	N33K	probably damaging	Het
Tmem25	T	C	9: 44,796,581	Y139C	probably damaging	Het
Trmt13	G	A	3: 116,582,626	T372M	probably damaging	Het
Ubr2	A	T	17: 46,983,298	M303K	probably damaging	Het
Usp34	A	G	11: 23,467,207	E2952G	probably damaging	Het
Zan	T	A	5: 137,391,658	I4851F	unknown	Het
Zfand4	C	T	6: 116,288,054	T160I	probably benign	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8017:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
R8768:Pdzd2	UTSW	15	12437166	missense	probably damaging	1.00
R8879:Pdzd2	UTSW	15	12402319	missense	probably damaging	1.00
R9019:Pdzd2	UTSW	15	12375526	missense	probably damaging	1.00
R9030:Pdzd2	UTSW	15	12374299	missense	probably benign	0.02
R9061:Pdzd2	UTSW	15	12374667	missense	possibly damaging	0.94
R9302:Pdzd2	UTSW	15	12374256	missense	possibly damaging	0.61
R9321:Pdzd2	UTSW	15	12385937	missense	probably benign	0.00
R9421:Pdzd2	UTSW	15	12375028	missense
R9515:Pdzd2	UTSW	15	12374535	missense	probably damaging	1.00
R9592:Pdzd2	UTSW	15	12458020	missense	probably damaging	1.00
R9614:Pdzd2	UTSW	15	12375400	missense	probably damaging	1.00
R9630:Pdzd2	UTSW	15	12374357	missense	probably benign	0.37
R9776:Pdzd2	UTSW	15	12457823	missense	probably benign	0.03
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCAAAACGGCCTCTCCATTC -3'
(R):5'- ACGAGCAAATAGAAATCTGTGCCCC -3'

Sequencing Primer
(F):5'- TTTGTCTGGGGTTCCCTCAT -3'
(R):5'- TAGAAATCTGTGCCCCAGGTG -3'

Posted On

2013-05-23