Mutagenetix > Incidental Mutation

Incidental Mutation 'R5113:Erc2'

394040

Institutional Source

Beutler Lab

Gene Symbol

Erc2

Ensembl Gene

ENSMUSG00000040640

Gene Name

ELKS/RAB6-interacting/CAST family member 2

Synonyms

ELKS2alpha, D14Ertd171e

MMRRC Submission

042701-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27622428-28478537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27652872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 16 (S16P)

Ref Sequence

ENSEMBL: ENSMUSP00000148076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210327] [ENSMUST00000211087] [ENSMUST00000211145]

AlphaFold

Q6PH08

Predicted Effect

probably benign
Transcript: ENSMUST00000090302
AA Change: S16P

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: S16P

Domain	Start	End	E-Value	Type
low complexity region	14	45	N/A	INTRINSIC
low complexity region	121	133	N/A	INTRINSIC
Pfam:Cast	150	907	N/A	PFAM
low complexity region	916	928	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209752

Predicted Effect

probably benign
Transcript: ENSMUST00000210135
AA Change: S16P

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000210327
AA Change: S16P

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000211087
AA Change: S16P

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000211145
AA Change: S16P

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox12e	A	G	11: 70,315,995	V622A	possibly damaging	Het
Ankef1	A	G	2: 136,552,441	N590S	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano3	A	T	2: 110,661,480	N867K	possibly damaging	Het
Ash1l	T	C	3: 89,066,275	V2547A	probably damaging	Het
Ccpg1os	T	A	9: 72,979,893	R111*	probably null	Het
Chil5	A	T	3: 106,017,978	V209E	possibly damaging	Het
Cltc	A	T	11: 86,722,321	C459S	probably damaging	Het
Col6a4	T	A	9: 106,066,960	D1105V	possibly damaging	Het
Cyp2c66	A	G	19: 39,163,438	D199G	probably benign	Het
Cyp4f18	A	G	8: 71,989,058		probably null	Het
Cysrt1	A	T	2: 25,239,351	C50S	possibly damaging	Het
Dapk1	A	G	13: 60,721,778	K278R	probably benign	Het
Eefsec	C	A	6: 88,281,575	S512I	probably damaging	Het
Emilin1	T	C	5: 30,920,620	F908L	possibly damaging	Het
Eml1	T	C	12: 108,537,337	V731A	possibly damaging	Het
Gfpt2	A	G	11: 49,823,799	R342G	probably damaging	Het
Gpr142	A	T	11: 114,804,317	Q36L	probably benign	Het
Grik5	A	G	7: 25,015,527	S681P	probably damaging	Het
Hecw1	A	T	13: 14,346,029	S208T	possibly damaging	Het
Hmgcr	G	A	13: 96,656,732	A464V	probably benign	Het
Igkv2-109	A	G	6: 68,303,085	T97A	possibly damaging	Het
Ino80	G	T	2: 119,431,945	Q687K	probably damaging	Het
Kdm4d	T	C	9: 14,464,113	N150D	probably damaging	Het
Klf4	A	G	4: 55,530,481	I210T	possibly damaging	Het
Klkb1	C	A	8: 45,270,697	Q560H	probably benign	Het
Lce1a2	A	T	3: 92,669,135	V40E	unknown	Het
Maob	T	C	X: 16,716,423	T400A	probably benign	Het
Mipol1	C	T	12: 57,496,499	T393I	probably benign	Het
Mst1	A	G	9: 108,082,247	D244G	probably damaging	Het
Nexn	G	A	3: 152,243,888	R258C	probably damaging	Het
Olfr1353	A	G	10: 78,970,203	I185V	probably benign	Het
Olfr748	A	C	14: 50,710,914	I195L	probably benign	Het
Olfr777	A	G	10: 129,268,666	I219T	probably damaging	Het
Olfr975	T	C	9: 39,949,925	N282S	probably damaging	Het
Optc	T	C	1: 133,900,977		probably benign	Het
Pabpc2	C	A	18: 39,775,383	P567Q	probably benign	Het
Ppm1j	A	G	3: 104,784,674	H324R	possibly damaging	Het
Reg3g	A	T	6: 78,466,561		probably null	Het
Sipa1l1	C	T	12: 82,440,908	A1652V	probably benign	Het
Ski	T	C	4: 155,159,392	T554A	probably benign	Het
Slfn5	G	A	11: 82,961,696	V883M	probably benign	Het
Stradb	T	C	1: 58,991,174		probably benign	Het
Tex19.1	A	G	11: 121,147,799	T328A	probably benign	Het
Tpsab1	T	C	17: 25,345,399	N27S	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttn	A	T	2: 76,812,900	L13225Q	probably damaging	Het
Vmn1r28	A	G	6: 58,265,858	T229A	probably benign	Het
Wapl	A	G	14: 34,724,754	K600E	probably damaging	Het
Zfp217	T	C	2: 170,114,058		probably null	Het

Other mutations in Erc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Erc2	APN	14	28040521	missense	probably damaging	0.98
IGL01862:Erc2	APN	14	28271569	splice site	probably benign
IGL01906:Erc2	APN	14	28141306	missense	probably damaging	0.99
IGL02177:Erc2	APN	14	27898623	missense	probably benign	0.00
IGL02481:Erc2	APN	14	27653071	missense	probably damaging	1.00
IGL02483:Erc2	APN	14	27653071	missense	probably damaging	1.00
IGL02623:Erc2	APN	14	27776980	missense	probably damaging	1.00
IGL03252:Erc2	APN	14	28475649	utr 3 prime	probably benign
IGL03378:Erc2	APN	14	28011723	missense	probably damaging	1.00
lobe	UTSW	14	28317251	missense	probably damaging	0.96
R0091:Erc2	UTSW	14	27776824	critical splice acceptor site	probably null
R0309:Erc2	UTSW	14	28141225	missense	probably damaging	0.98
R0357:Erc2	UTSW	14	27777022	missense	probably damaging	0.99
R0378:Erc2	UTSW	14	28011694	missense	probably damaging	1.00
R0550:Erc2	UTSW	14	28271651	missense	possibly damaging	0.74
R0815:Erc2	UTSW	14	28025148	missense	probably benign	0.04
R0863:Erc2	UTSW	14	28025148	missense	probably benign	0.04
R1121:Erc2	UTSW	14	28475655	utr 3 prime	probably benign
R1164:Erc2	UTSW	14	28302972	missense	probably damaging	0.99
R1498:Erc2	UTSW	14	28302898	missense	probably benign	0.27
R1500:Erc2	UTSW	14	28271660	missense	probably damaging	0.98
R1555:Erc2	UTSW	14	28011665	missense	probably damaging	0.99
R1894:Erc2	UTSW	14	28141228	missense	probably damaging	0.99
R1950:Erc2	UTSW	14	27912900	missense	probably damaging	0.99
R1991:Erc2	UTSW	14	28011636	missense	probably benign	0.34
R2698:Erc2	UTSW	14	28271705	missense	probably benign	0.06
R2847:Erc2	UTSW	14	28040488	missense	probably damaging	0.97
R3015:Erc2	UTSW	14	28011775	critical splice donor site	probably null
R3612:Erc2	UTSW	14	27777177	missense	possibly damaging	0.69
R3759:Erc2	UTSW	14	28025163	missense	possibly damaging	0.94
R3857:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R3858:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R3859:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R4556:Erc2	UTSW	14	28302904	missense	probably damaging	1.00
R4739:Erc2	UTSW	14	27776881	missense	probably damaging	1.00
R4898:Erc2	UTSW	14	27653328	missense	probably damaging	1.00
R5068:Erc2	UTSW	14	28302943	missense	possibly damaging	0.63
R5418:Erc2	UTSW	14	27966510	missense	probably benign	0.14
R5741:Erc2	UTSW	14	28302869	splice site	probably null
R5819:Erc2	UTSW	14	28141369	missense	probably damaging	0.97
R5930:Erc2	UTSW	14	27776858	missense	probably damaging	0.99
R6073:Erc2	UTSW	14	28011636	missense	probably benign	0.00
R6150:Erc2	UTSW	14	28141291	missense	probably damaging	0.97
R6182:Erc2	UTSW	14	28317253	missense	probably damaging	0.99
R6188:Erc2	UTSW	14	28317251	missense	probably damaging	0.96
R6267:Erc2	UTSW	14	28080155	missense	probably damaging	1.00
R6296:Erc2	UTSW	14	28080155	missense	probably damaging	1.00
R6730:Erc2	UTSW	14	27898567	missense	possibly damaging	0.95
R6969:Erc2	UTSW	14	27898596	missense	probably damaging	1.00
R7095:Erc2	UTSW	14	27898593	missense	probably damaging	0.99
R7221:Erc2	UTSW	14	27653158	missense	probably damaging	0.97
R7365:Erc2	UTSW	14	28040389	missense	probably damaging	1.00
R7454:Erc2	UTSW	14	28302991	missense	possibly damaging	0.92
R7763:Erc2	UTSW	14	27876204	critical splice donor site	probably null
R7784:Erc2	UTSW	14	27898594	missense	probably damaging	0.96
R7890:Erc2	UTSW	14	28040341	critical splice acceptor site	probably null
R7894:Erc2	UTSW	14	27777208	missense	probably damaging	1.00
R8031:Erc2	UTSW	14	28011692	missense	probably damaging	0.99
R8206:Erc2	UTSW	14	28303015	splice site	probably null
R8273:Erc2	UTSW	14	27777139	missense	probably benign	0.41
R8304:Erc2	UTSW	14	27653165	missense	probably damaging	0.99
R8387:Erc2	UTSW	14	27653296	missense	possibly damaging	0.92
R8751:Erc2	UTSW	14	28080188	missense	possibly damaging	0.78
R8851:Erc2	UTSW	14	28317259	missense	probably null	0.99
R9130:Erc2	UTSW	14	28029461	missense	probably benign	0.25
R9292:Erc2	UTSW	14	27776842	missense	probably damaging	1.00
R9441:Erc2	UTSW	14	28080157	missense	possibly damaging	0.58
R9452:Erc2	UTSW	14	28011733	missense	probably damaging	1.00
R9529:Erc2	UTSW	14	28475766	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAGTGGAGTCATTTCCTGGTAC -3'
(R):5'- CCATACACCGCTCGATTTGTCG -3'

Sequencing Primer
(F):5'- CTCTTCAGTAGCACCACA -3'
(R):5'- GGGTAAGTTGTCGATGCCACC -3'

Posted On

2016-06-15