Incidental Mutation 'R5113:Wapl'
ID 394041
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission 042701-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5113 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34446711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 600 (K600E)
Ref Sequence ENSEMBL: ENSMUSP00000087481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably damaging
Transcript: ENSMUST00000048263
AA Change: K606E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: K606E

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: K600E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: K600E

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect probably benign
Transcript: ENSMUST00000151285
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169910
AA Change: K606E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: K606E

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172658
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,206,821 (GRCm39) V622A possibly damaging Het
Ankef1 A G 2: 136,394,361 (GRCm39) N590S probably benign Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano3 A T 2: 110,491,825 (GRCm39) N867K possibly damaging Het
Ash1l T C 3: 88,973,582 (GRCm39) V2547A probably damaging Het
Chil5 A T 3: 105,925,294 (GRCm39) V209E possibly damaging Het
Cltc A T 11: 86,613,147 (GRCm39) C459S probably damaging Het
Col6a4 T A 9: 105,944,159 (GRCm39) D1105V possibly damaging Het
Cyp2c66 A G 19: 39,151,882 (GRCm39) D199G probably benign Het
Cyp4f18 A G 8: 72,742,902 (GRCm39) probably null Het
Cysrt1 A T 2: 25,129,363 (GRCm39) C50S possibly damaging Het
Dapk1 A G 13: 60,869,592 (GRCm39) K278R probably benign Het
Eefsec C A 6: 88,258,557 (GRCm39) S512I probably damaging Het
Emilin1 T C 5: 31,077,964 (GRCm39) F908L possibly damaging Het
Eml1 T C 12: 108,503,596 (GRCm39) V731A possibly damaging Het
Erc2 T C 14: 27,374,829 (GRCm39) S16P probably benign Het
Gfpt2 A G 11: 49,714,626 (GRCm39) R342G probably damaging Het
Gpr142 A T 11: 114,695,143 (GRCm39) Q36L probably benign Het
Grik5 A G 7: 24,714,952 (GRCm39) S681P probably damaging Het
Hecw1 A T 13: 14,520,614 (GRCm39) S208T possibly damaging Het
Hmgcr G A 13: 96,793,240 (GRCm39) A464V probably benign Het
Igkv2-109 A G 6: 68,280,069 (GRCm39) T97A possibly damaging Het
Ino80 G T 2: 119,262,426 (GRCm39) Q687K probably damaging Het
Kdm4d T C 9: 14,375,409 (GRCm39) N150D probably damaging Het
Klf4 A G 4: 55,530,481 (GRCm39) I210T possibly damaging Het
Klkb1 C A 8: 45,723,734 (GRCm39) Q560H probably benign Het
Lce1a2 A T 3: 92,576,442 (GRCm39) V40E unknown Het
Maob T C X: 16,582,662 (GRCm39) T400A probably benign Het
Mipol1 C T 12: 57,543,285 (GRCm39) T393I probably benign Het
Mst1 A G 9: 107,959,446 (GRCm39) D244G probably damaging Het
Nexn G A 3: 151,949,525 (GRCm39) R258C probably damaging Het
Optc T C 1: 133,828,715 (GRCm39) probably benign Het
Or10d5 T C 9: 39,861,221 (GRCm39) N282S probably damaging Het
Or11h23 A C 14: 50,948,371 (GRCm39) I195L probably benign Het
Or6c207 A G 10: 129,104,535 (GRCm39) I219T probably damaging Het
Or7a37 A G 10: 78,806,037 (GRCm39) I185V probably benign Het
Pabpc2 C A 18: 39,908,436 (GRCm39) P567Q probably benign Het
Pierce2 T A 9: 72,887,175 (GRCm39) R111* probably null Het
Ppm1j A G 3: 104,691,990 (GRCm39) H324R possibly damaging Het
Reg3g A T 6: 78,443,544 (GRCm39) probably null Het
Sipa1l1 C T 12: 82,487,682 (GRCm39) A1652V probably benign Het
Ski T C 4: 155,243,849 (GRCm39) T554A probably benign Het
Slfn5 G A 11: 82,852,522 (GRCm39) V883M probably benign Het
Stradb T C 1: 59,030,333 (GRCm39) probably benign Het
Tex19.1 A G 11: 121,038,625 (GRCm39) T328A probably benign Het
Tpsab1 T C 17: 25,564,373 (GRCm39) N27S possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn A T 2: 76,643,244 (GRCm39) L13225Q probably damaging Het
Vmn1r28 A G 6: 58,242,843 (GRCm39) T229A probably benign Het
Zfp217 T C 2: 169,955,978 (GRCm39) probably null Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TAGGAACTTTCAGCAGCCTCC -3'
(R):5'- GTTCAAAATGTGGCTAGCAATGTAGTG -3'

Sequencing Primer
(F):5'- AACTTTCAGCAGCCTCCCTCTTC -3'
(R):5'- TGGCTAGCAATGTAGTGATATTTG -3'
Posted On 2016-06-15