Incidental Mutation 'R5113:Olfr748'
ID 394042
Institutional Source Beutler Lab
Gene Symbol Olfr748
Ensembl Gene ENSMUSG00000060084
Gene Name olfactory receptor 748
Synonyms GA_x6K02T2PMLR-6454789-6455712, MOR106-9P
MMRRC Submission 042701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R5113 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 50707373-50713797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 50710914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 195 (I195L)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
AlphaFold E9Q9Z0
Predicted Effect probably benign
Transcript: ENSMUST00000073561
AA Change: I195L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: I195L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213101
AA Change: I195L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Olfr748
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Olfr748 APN 14 50710993 missense possibly damaging 0.95
IGL02965:Olfr748 APN 14 50711196 missense probably damaging 1.00
R0576:Olfr748 UTSW 14 50711204 missense probably damaging 0.98
R1184:Olfr748 UTSW 14 50710614 missense probably benign 0.01
R2129:Olfr748 UTSW 14 50710636 missense probably damaging 0.99
R2895:Olfr748 UTSW 14 50710516 missense probably damaging 0.99
R2896:Olfr748 UTSW 14 50710516 missense probably damaging 0.99
R4017:Olfr748 UTSW 14 50710876 missense probably benign 0.03
R5053:Olfr748 UTSW 14 50710511 nonsense probably null
R5057:Olfr748 UTSW 14 50711212 missense probably damaging 1.00
R5294:Olfr748 UTSW 14 50710443 missense possibly damaging 0.95
R5294:Olfr748 UTSW 14 50710779 missense probably benign 0.01
R5499:Olfr748 UTSW 14 50710867 missense probably damaging 1.00
R5582:Olfr748 UTSW 14 50710968 missense probably damaging 1.00
R5727:Olfr748 UTSW 14 50710360 missense possibly damaging 0.74
R6797:Olfr748 UTSW 14 50711106 missense probably damaging 1.00
R7685:Olfr748 UTSW 14 50710758 missense possibly damaging 0.95
R7717:Olfr748 UTSW 14 50710762 missense probably damaging 1.00
R7778:Olfr748 UTSW 14 50710471 missense possibly damaging 0.60
R8276:Olfr748 UTSW 14 50710830 missense probably benign 0.28
R8839:Olfr748 UTSW 14 50710500 missense possibly damaging 0.73
R9322:Olfr748 UTSW 14 50711050 missense probably damaging 1.00
R9358:Olfr748 UTSW 14 50710345 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCGGTACCTAGCCATCTGC -3'
(R):5'- TTGGGAGTCACATACATCACC -3'

Sequencing Primer
(F):5'- TCCATCATGACTAGGCAATTCTG -3'
(R):5'- GGGAGTCACATACATCACCATTATGG -3'
Posted On 2016-06-15