Mutagenetix > Incidental Mutation

Incidental Mutation 'R0446:Rbfox2'

39406

Institutional Source

Beutler Lab

Gene Symbol

Rbfox2

Ensembl Gene

ENSMUSG00000033565

Gene Name

RNA binding protein, fox-1 homolog (C. elegans) 2

Synonyms

2810460A15Rik, Fxh, Fbm2, Rbm9

MMRRC Submission

038647-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.611) question?

Stock #

R0446 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77078990-77307004 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77099255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 269 (Y269N)

Ref Sequence

ENSEMBL: ENSMUSP00000154522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048145] [ENSMUST00000111581] [ENSMUST00000166610] [ENSMUST00000171751] [ENSMUST00000227314] [ENSMUST00000227533] [ENSMUST00000227930] [ENSMUST00000228087] [ENSMUST00000228558]

AlphaFold

Q8BP71

Predicted Effect

probably benign
Transcript: ENSMUST00000048145
AA Change: Y315N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000048056
Gene: ENSMUSG00000033565
AA Change: Y315N

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
low complexity region	91	107	N/A	INTRINSIC
low complexity region	139	150	N/A	INTRINSIC
low complexity region	156	178	N/A	INTRINSIC
RRM	181	252	1.77e-24	SMART
Pfam:Fox-1_C	319	374	2.9e-18	PFAM
low complexity region	375	390	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111581
AA Change: Y247N

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000129372
Gene: ENSMUSG00000033565
AA Change: Y247N

Domain	Start	End	E-Value	Type
low complexity region	23	39	N/A	INTRINSIC
low complexity region	71	82	N/A	INTRINSIC
low complexity region	88	110	N/A	INTRINSIC
RRM	113	184	1.77e-24	SMART
Pfam:Fox-1_C	252	350	3.7e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166610
AA Change: Y247N

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000130673
Gene: ENSMUSG00000033565
AA Change: Y247N

Domain	Start	End	E-Value	Type
low complexity region	23	39	N/A	INTRINSIC
low complexity region	71	82	N/A	INTRINSIC
low complexity region	88	110	N/A	INTRINSIC
RRM	113	184	1.77e-24	SMART
Pfam:Fox-1_C	255	353	6.2e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171751
AA Change: Y315N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000130739
Gene: ENSMUSG00000033565
AA Change: Y315N

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
low complexity region	91	107	N/A	INTRINSIC
low complexity region	139	150	N/A	INTRINSIC
low complexity region	156	178	N/A	INTRINSIC
RRM	181	252	1.77e-24	SMART
Pfam:Fox-1_C	324	421	7e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181870

Predicted Effect

probably damaging
Transcript: ENSMUST00000227314
AA Change: Y247N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227533
AA Change: Y215N

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227930
AA Change: Y149N

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000228087
AA Change: Y247N

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

unknown
Transcript: ENSMUST00000228361
AA Change: Y260N

Predicted Effect

probably damaging
Transcript: ENSMUST00000228558
AA Change: Y269N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit normal spontaneous and kainic acid-induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	G	A	2: 91,304,764	T20I	possibly damaging	Het
4930435E12Rik	G	A	16: 38,828,702	T15I	probably benign	Het
4933434E20Rik	A	G	3: 90,064,459	T42A	probably benign	Het
Actr3b	T	A	5: 25,831,732	I181K	probably damaging	Het
Avl9	G	T	6: 56,736,483	R242L	probably benign	Het
B3galt4	T	C	17: 33,951,018	E82G	probably benign	Het
Bag1	G	A	4: 40,936,609	T349I	probably benign	Het
Brip1	A	T	11: 86,157,601	L305Q	probably damaging	Het
Cdipt	A	G	7: 126,978,264	T61A	probably damaging	Het
Cmya5	T	A	13: 93,093,656	R1641S	probably benign	Het
Cog7	T	C	7: 121,937,072	D515G	probably benign	Het
Cpsf4	T	A	5: 145,177,244	L171Q	probably damaging	Het
Cuzd1	A	T	7: 131,316,280		probably null	Het
Dapk1	T	A	13: 60,725,287		probably null	Het
Diaph1	A	G	18: 37,853,590	V1114A	possibly damaging	Het
Emx2	A	T	19: 59,463,916	K211*	probably null	Het
Fam160b1	G	A	19: 57,381,407	D461N	probably benign	Het
Fam170a	T	A	18: 50,280,632	C55S	possibly damaging	Het
Fbxw26	A	G	9: 109,743,720	S119P	probably benign	Het
Fryl	G	A	5: 73,097,417	T894M	possibly damaging	Het
Gad1-ps	C	A	10: 99,445,521		noncoding transcript	Het
Gm14124	A	G	2: 150,268,073	T228A	possibly damaging	Het
Gss	T	C	2: 155,567,745	E257G	probably benign	Het
Klhdc1	A	C	12: 69,283,308	S404R	probably benign	Het
Kmt2e	T	A	5: 23,497,534		probably null	Het
Krt20	G	A	11: 99,437,776	Q108*	probably null	Het
Lmnb1	T	A	18: 56,743,259	S480T	probably benign	Het
Lyst	T	A	13: 13,638,048	M1015K	probably benign	Het
Mdm1	T	G	10: 118,152,056	S290A	probably benign	Het
Mkln1	T	A	6: 31,449,504	F238I	probably damaging	Het
Mrgprb3	A	G	7: 48,643,236	V189A	probably benign	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Neurod6	C	T	6: 55,679,629	E8K	probably benign	Het
Nlrp12	T	C	7: 3,234,029	I747V	probably benign	Het
Notch4	C	T	17: 34,565,363	R43W	possibly damaging	Het
Obscn	A	T	11: 58,995,412		probably benign	Het
Olfr1153	T	C	2: 87,896,855	Y219H	possibly damaging	Het
Olfr1346	T	C	7: 6,475,025	V305A	probably benign	Het
Olfr480	A	T	7: 108,066,725	Y24*	probably null	Het
Olfr522	A	T	7: 140,162,471	S160T	probably damaging	Het
Olfr920	G	T	9: 38,755,818	L43F	probably damaging	Het
Olfr958	A	T	9: 39,550,451	I140N	probably damaging	Het
Orc5	C	T	5: 22,546,457	V85I	probably benign	Het
Pccb	T	C	9: 100,982,797	D468G	probably damaging	Het
Pdzd2	A	T	15: 12,375,024	V1675E	probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pltp	A	T	2: 164,854,400	N97K	probably damaging	Het
Polr1a	T	C	6: 71,950,664		probably null	Het
Prss42	G	A	9: 110,799,273	V162I	possibly damaging	Het
Rftn2	A	T	1: 55,214,195	I83K	probably damaging	Het
S1pr4	A	T	10: 81,498,989	I217N	probably damaging	Het
Slc23a2	T	C	2: 132,078,433	K184R	probably benign	Het
Slc6a19	T	C	13: 73,691,695	N156S	probably benign	Het
Svep1	C	T	4: 58,088,280	G1723D	probably damaging	Het
Tbc1d32	T	A	10: 56,192,898	H358L	possibly damaging	Het
Tigit	G	T	16: 43,662,271	N33K	probably damaging	Het
Tmem25	T	C	9: 44,796,581	Y139C	probably damaging	Het
Trmt13	G	A	3: 116,582,626	T372M	probably damaging	Het
Ubr2	A	T	17: 46,983,298	M303K	probably damaging	Het
Usp34	A	G	11: 23,467,207	E2952G	probably damaging	Het
Zan	T	A	5: 137,391,658	I4851F	unknown	Het
Zfand4	C	T	6: 116,288,054	T160I	probably benign	Het

Other mutations in Rbfox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Rbfox2	APN	15	77102936	missense	probably damaging	1.00
R0026:Rbfox2	UTSW	15	77084157	missense	possibly damaging	0.66
R0130:Rbfox2	UTSW	15	77091857	intron	probably benign
R0731:Rbfox2	UTSW	15	77099279	missense	probably benign	0.21
R3013:Rbfox2	UTSW	15	77132920	missense	probably damaging	1.00
R3715:Rbfox2	UTSW	15	77099251	missense	probably damaging	0.97
R4094:Rbfox2	UTSW	15	77132725	missense	probably damaging	0.99
R4543:Rbfox2	UTSW	15	77306368	missense	probably benign	0.01
R4799:Rbfox2	UTSW	15	77091818	missense	probably benign	0.28
R6194:Rbfox2	UTSW	15	77084157	missense	possibly damaging	0.66
R7316:Rbfox2	UTSW	15	77132729	missense	possibly damaging	0.92
R7501:Rbfox2	UTSW	15	77105634	missense	probably benign	0.36
R7687:Rbfox2	UTSW	15	77306494	missense	unknown
R8030:Rbfox2	UTSW	15	77085576	critical splice donor site	probably null
R8103:Rbfox2	UTSW	15	77099454	missense	probably damaging	1.00
R9093:Rbfox2	UTSW	15	77306458	missense	probably benign
RF027:Rbfox2	UTSW	15	77132773	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGCAGGCGAGACATGCTCTTATC -3'
(R):5'- TCAGGCTGGAAGTTAAGCCCAGTAG -3'

Sequencing Primer
(F):5'- GATCACATCCAGGTAGGATAGTTAC -3'
(R):5'- TTAAGCCCAGTAGTTGGAGC -3'

Posted On

2013-05-23