Incidental Mutation 'R0446:Rbfox2'
ID39406
Institutional Source Beutler Lab
Gene Symbol Rbfox2
Ensembl Gene ENSMUSG00000033565
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 2
Synonyms2810460A15Rik, Fxh, Fbm2, Rbm9
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.718) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77078990-77307004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77099255 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 269 (Y269N)
Ref Sequence ENSEMBL: ENSMUSP00000154522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048145] [ENSMUST00000111581] [ENSMUST00000166610] [ENSMUST00000171751] [ENSMUST00000227314] [ENSMUST00000227533] [ENSMUST00000227930] [ENSMUST00000228087] [ENSMUST00000228558]
Predicted Effect probably benign
Transcript: ENSMUST00000048145
AA Change: Y315N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000048056
Gene: ENSMUSG00000033565
AA Change: Y315N

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 319 374 2.9e-18 PFAM
low complexity region 375 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111581
AA Change: Y247N

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129372
Gene: ENSMUSG00000033565
AA Change: Y247N

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 252 350 3.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166610
AA Change: Y247N

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130673
Gene: ENSMUSG00000033565
AA Change: Y247N

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 255 353 6.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171751
AA Change: Y315N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130739
Gene: ENSMUSG00000033565
AA Change: Y315N

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 324 421 7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181870
Predicted Effect probably damaging
Transcript: ENSMUST00000227314
AA Change: Y247N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227533
AA Change: Y215N

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227930
AA Change: Y149N

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000228087
AA Change: Y247N

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000228361
AA Change: Y260N
Predicted Effect probably damaging
Transcript: ENSMUST00000228558
AA Change: Y269N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit normal spontaneous and kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Rbfox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Rbfox2 APN 15 77102936 missense probably damaging 1.00
R0026:Rbfox2 UTSW 15 77084157 missense possibly damaging 0.66
R0130:Rbfox2 UTSW 15 77091857 intron probably benign
R0731:Rbfox2 UTSW 15 77099279 missense probably benign 0.21
R3013:Rbfox2 UTSW 15 77132920 missense probably damaging 1.00
R3715:Rbfox2 UTSW 15 77099251 missense probably damaging 0.97
R4094:Rbfox2 UTSW 15 77132725 missense probably damaging 0.99
R4543:Rbfox2 UTSW 15 77306368 missense probably benign 0.01
R4799:Rbfox2 UTSW 15 77091818 missense probably benign 0.28
R6194:Rbfox2 UTSW 15 77084157 missense possibly damaging 0.66
R7316:Rbfox2 UTSW 15 77132729 missense possibly damaging 0.92
R7501:Rbfox2 UTSW 15 77105634 missense probably benign 0.36
R7687:Rbfox2 UTSW 15 77306494 missense unknown
R8030:Rbfox2 UTSW 15 77085576 critical splice donor site probably null
R8103:Rbfox2 UTSW 15 77099454 missense probably damaging 1.00
RF027:Rbfox2 UTSW 15 77132773 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCAGGCGAGACATGCTCTTATC -3'
(R):5'- TCAGGCTGGAAGTTAAGCCCAGTAG -3'

Sequencing Primer
(F):5'- GATCACATCCAGGTAGGATAGTTAC -3'
(R):5'- TTAAGCCCAGTAGTTGGAGC -3'
Posted On2013-05-23