Incidental Mutation 'R5114:Zfp383'
ID394083
Institutional Source Beutler Lab
Gene Symbol Zfp383
Ensembl Gene ENSMUSG00000099689
Gene Namezinc finger protein 383
Synonyms1110003H10Rik
MMRRC Submission 042702-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R5114 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29908223-29916813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29914741 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 140 (D140E)
Ref Sequence ENSEMBL: ENSMUSP00000140742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186475] [ENSMUST00000187028]
Predicted Effect probably damaging
Transcript: ENSMUST00000186475
AA Change: D140E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140742
Gene: ENSMUSG00000099689
AA Change: D140E

DomainStartEndE-ValueType
KRAB 27 87 4.95e-37 SMART
low complexity region 165 173 N/A INTRINSIC
ZnF_C2H2 185 207 1.47e-3 SMART
ZnF_C2H2 213 235 7.15e-2 SMART
ZnF_C2H2 241 263 1.79e-2 SMART
ZnF_C2H2 269 291 4.17e-3 SMART
ZnF_C2H2 297 319 3.69e-4 SMART
ZnF_C2H2 325 347 2.27e-4 SMART
ZnF_C2H2 353 375 1.84e-4 SMART
ZnF_C2H2 381 403 6.52e-5 SMART
ZnF_C2H2 409 431 1.58e-3 SMART
ZnF_C2H2 437 459 1.69e-3 SMART
ZnF_C2H2 465 487 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187028
SMART Domains Protein: ENSMUSP00000141019
Gene: ENSMUSG00000099689

DomainStartEndE-ValueType
KRAB 27 87 5.6e-22 SMART
low complexity region 124 142 N/A INTRINSIC
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a KRAB-related zinc finger protein that inhibits the transcription of some MAPK signaling pathway genes. The repressor activity resides in the KRAB domain of the encoded protein. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,358 M431L probably benign Het
1700066B19Rik A G 18: 35,728,841 Y126C probably damaging Het
1810041L15Rik T C 15: 84,417,226 D72G probably damaging Het
5830454E08Rik T A 9: 120,577,627 probably benign Het
Ada G A 2: 163,730,486 R225C probably benign Het
Adamts9 T C 6: 92,890,273 K625R probably benign Het
Ano1 T C 7: 144,657,083 I182V possibly damaging Het
Aox4 T C 1: 58,246,286 V643A possibly damaging Het
Arcn1 T C 9: 44,760,144 I29V probably benign Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Asb10 A T 5: 24,540,742 L62Q probably damaging Het
Atp23 T A 10: 126,887,534 H233L possibly damaging Het
BC005561 T A 5: 104,519,876 F755I probably damaging Het
Bglap2 C T 3: 88,382,125 probably benign Het
Carnmt1 T C 19: 18,677,734 S84P probably damaging Het
Ccdc152 A G 15: 3,282,837 I180T probably damaging Het
Cdr2l T C 11: 115,393,360 F174S probably damaging Het
Celsr2 C T 3: 108,393,996 V2695I probably benign Het
Chd1 C A 17: 15,728,198 S127R probably benign Het
Chmp4c T A 3: 10,385,586 F75L probably benign Het
Col13a1 A C 10: 61,890,101 V260G possibly damaging Het
Col5a1 A G 2: 28,025,652 N183D probably damaging Het
Cpn1 C T 19: 43,986,195 V32M probably damaging Het
Cxcl1 A G 5: 90,891,514 M39V probably benign Het
Dpep2 T A 8: 105,986,193 D455V probably damaging Het
Dpp7 G A 2: 25,352,737 T441I possibly damaging Het
Dst C A 1: 34,202,559 H4001N probably damaging Het
Epg5 G A 18: 77,995,613 A1519T probably benign Het
Esrp2 C T 8: 106,132,188 V606I probably benign Het
Fbxo40 T C 16: 36,968,874 K625E probably damaging Het
Gbp2b A T 3: 142,598,185 I14F probably damaging Het
Gpr37l1 G T 1: 135,166,938 F189L probably damaging Het
Heatr5a G A 12: 51,956,237 Q161* probably null Het
Hspa4l T C 3: 40,745,765 Y30H possibly damaging Het
Hspg2 G A 4: 137,511,926 C388Y probably damaging Het
Kcna1 A G 6: 126,642,367 I330T probably damaging Het
Klhl3 T A 13: 58,018,967 Y350F probably benign Het
Kntc1 T C 5: 123,781,055 probably null Het
Krtap10-4 A T 10: 77,826,686 C109* probably null Het
Lrch4 T C 5: 137,637,917 S377P probably benign Het
Lrrc8c C A 5: 105,607,483 H375N probably damaging Het
Lsg1 T C 16: 30,561,720 E633G probably damaging Het
Mcoln1 T C 8: 3,510,697 probably benign Het
Med12l C A 3: 59,259,688 T1523K possibly damaging Het
Mrps27 A T 13: 99,411,465 probably benign Het
Mzb1 T A 18: 35,647,664 Y158F probably benign Het
Nat8l T A 5: 33,998,479 C160S probably damaging Het
Ncf4 T C 15: 78,262,393 probably benign Het
Olfr362 A T 2: 37,104,802 Y283N probably damaging Het
Olfr98 T C 17: 37,262,839 Y275C probably damaging Het
Pak2 T A 16: 32,043,118 probably benign Het
Pcdhga12 T C 18: 37,768,107 I664T probably benign Het
Pcnx2 A C 8: 125,838,010 L1048R possibly damaging Het
Pcsk5 T C 19: 17,675,585 M246V probably damaging Het
Pkd2l2 T A 18: 34,433,302 V522D probably benign Het
Plekhh1 A T 12: 79,069,106 M808L probably benign Het
Plpp2 C A 10: 79,527,139 R157L probably benign Het
Plrg1 T A 3: 83,071,251 H441Q probably benign Het
Pnpla6 T C 8: 3,522,613 V300A probably damaging Het
Ptprb A T 10: 116,348,183 K1633N possibly damaging Het
Ralgapa1 A G 12: 55,612,723 V2004A possibly damaging Het
Rasd1 G T 11: 59,964,107 S182R possibly damaging Het
Rc3h2 A T 2: 37,398,361 probably null Het
Rrp1b T A 17: 32,036,471 probably benign Het
Ruvbl1 T C 6: 88,497,290 I425T probably benign Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Slc12a2 A G 18: 57,899,272 Y348C probably damaging Het
Slc14a2 C A 18: 78,195,748 V219L possibly damaging Het
Smc1b G T 15: 85,064,984 P1242Q probably damaging Het
Snx27 T A 3: 94,524,244 D281V probably damaging Het
Spem2 C T 11: 69,817,147 V331I probably benign Het
Sptb C A 12: 76,609,278 K1343N probably damaging Het
Sult2a8 T C 7: 14,413,659 I236V probably benign Het
Syk A G 13: 52,611,035 E66G probably damaging Het
Synm T A 7: 67,735,658 E310V probably damaging Het
Tas2r118 G A 6: 23,969,210 A284V probably benign Het
Tlr11 A G 14: 50,363,121 N855D possibly damaging Het
Tmem230 G T 2: 132,245,951 probably benign Het
Trappc8 G A 18: 20,844,180 T844I probably benign Het
Trmt44 T C 5: 35,565,468 S419G possibly damaging Het
Trpv1 T A 11: 73,241,748 V396E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp2 A G 7: 140,007,441 I337T possibly damaging Het
Ubr4 T C 4: 139,410,623 I1097T probably damaging Het
Vmn2r61 T C 7: 42,300,529 F791S possibly damaging Het
Zdhhc2 T A 8: 40,445,784 M45K probably benign Het
Zfp712 C A 13: 67,041,361 K367N probably damaging Het
Zfp763 C T 17: 33,018,975 A399T probably damaging Het
Other mutations in Zfp383
AlleleSourceChrCoordTypePredicted EffectPPH Score
flyer UTSW 7 29914727 missense probably benign
R4796:Zfp383 UTSW 7 29914838 missense possibly damaging 0.72
R5372:Zfp383 UTSW 7 29915270 nonsense probably null
R5622:Zfp383 UTSW 7 29912190 missense probably damaging 1.00
R5963:Zfp383 UTSW 7 29915678 missense possibly damaging 0.84
R6639:Zfp383 UTSW 7 29914727 missense probably benign
R6952:Zfp383 UTSW 7 29914955 missense probably benign 0.00
R7067:Zfp383 UTSW 7 29908646 start codon destroyed probably null 0.01
R7635:Zfp383 UTSW 7 29915271 missense probably damaging 1.00
R7809:Zfp383 UTSW 7 29910236 missense possibly damaging 0.86
R7839:Zfp383 UTSW 7 29915058 missense probably damaging 1.00
R7896:Zfp383 UTSW 7 29912201 missense probably damaging 0.99
R7922:Zfp383 UTSW 7 29915058 missense probably damaging 1.00
R7979:Zfp383 UTSW 7 29912201 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGTAAGCCTGTGTCATTTACTTAC -3'
(R):5'- TAAACTGTGAGTTCTGGGTAAAGAC -3'

Sequencing Primer
(F):5'- GCCTGTGTCATTTACTTACTAAACAG -3'
(R):5'- GTTCTGGGTAAAGACCTTTTTACAC -3'
Posted On2016-06-15