Incidental Mutation 'R5114:Mcoln1'
ID394088
Institutional Source Beutler Lab
Gene Symbol Mcoln1
Ensembl Gene ENSMUSG00000004567
Gene Namemucolipin 1
SynonymsTRPML1, mucolipidin, 2210015I05Rik
MMRRC Submission 042702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5114 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3500457-3515232 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 3510697 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000004683] [ENSMUST00000111070] [ENSMUST00000160338] [ENSMUST00000207146] [ENSMUST00000208002] [ENSMUST00000208306] [ENSMUST00000208310] [ENSMUST00000208359] [ENSMUST00000208762]
Predicted Effect probably benign
Transcript: ENSMUST00000004681
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000004683
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159808
Predicted Effect probably benign
Transcript: ENSMUST00000160338
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161705
Predicted Effect probably benign
Transcript: ENSMUST00000161842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162797
Predicted Effect probably benign
Transcript: ENSMUST00000207146
Predicted Effect probably benign
Transcript: ENSMUST00000208002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208006
Predicted Effect probably benign
Transcript: ENSMUST00000208306
Predicted Effect probably benign
Transcript: ENSMUST00000208310
Predicted Effect probably benign
Transcript: ENSMUST00000208359
Predicted Effect probably benign
Transcript: ENSMUST00000208762
Predicted Effect probably benign
Transcript: ENSMUST00000208943
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,358 M431L probably benign Het
1700066B19Rik A G 18: 35,728,841 Y126C probably damaging Het
1810041L15Rik T C 15: 84,417,226 D72G probably damaging Het
5830454E08Rik T A 9: 120,577,627 probably benign Het
Ada G A 2: 163,730,486 R225C probably benign Het
Adamts9 T C 6: 92,890,273 K625R probably benign Het
Ano1 T C 7: 144,657,083 I182V possibly damaging Het
Aox4 T C 1: 58,246,286 V643A possibly damaging Het
Arcn1 T C 9: 44,760,144 I29V probably benign Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Asb10 A T 5: 24,540,742 L62Q probably damaging Het
Atp23 T A 10: 126,887,534 H233L possibly damaging Het
BC005561 T A 5: 104,519,876 F755I probably damaging Het
Bglap2 C T 3: 88,382,125 probably benign Het
Carnmt1 T C 19: 18,677,734 S84P probably damaging Het
Ccdc152 A G 15: 3,282,837 I180T probably damaging Het
Cdr2l T C 11: 115,393,360 F174S probably damaging Het
Celsr2 C T 3: 108,393,996 V2695I probably benign Het
Chd1 C A 17: 15,728,198 S127R probably benign Het
Chmp4c T A 3: 10,385,586 F75L probably benign Het
Col13a1 A C 10: 61,890,101 V260G possibly damaging Het
Col5a1 A G 2: 28,025,652 N183D probably damaging Het
Cpn1 C T 19: 43,986,195 V32M probably damaging Het
Cxcl1 A G 5: 90,891,514 M39V probably benign Het
Dpep2 T A 8: 105,986,193 D455V probably damaging Het
Dpp7 G A 2: 25,352,737 T441I possibly damaging Het
Dst C A 1: 34,202,559 H4001N probably damaging Het
Epg5 G A 18: 77,995,613 A1519T probably benign Het
Esrp2 C T 8: 106,132,188 V606I probably benign Het
Fbxo40 T C 16: 36,968,874 K625E probably damaging Het
Gbp2b A T 3: 142,598,185 I14F probably damaging Het
Gpr37l1 G T 1: 135,166,938 F189L probably damaging Het
Heatr5a G A 12: 51,956,237 Q161* probably null Het
Hspa4l T C 3: 40,745,765 Y30H possibly damaging Het
Hspg2 G A 4: 137,511,926 C388Y probably damaging Het
Kcna1 A G 6: 126,642,367 I330T probably damaging Het
Klhl3 T A 13: 58,018,967 Y350F probably benign Het
Kntc1 T C 5: 123,781,055 probably null Het
Krtap10-4 A T 10: 77,826,686 C109* probably null Het
Lrch4 T C 5: 137,637,917 S377P probably benign Het
Lrrc8c C A 5: 105,607,483 H375N probably damaging Het
Lsg1 T C 16: 30,561,720 E633G probably damaging Het
Med12l C A 3: 59,259,688 T1523K possibly damaging Het
Mrps27 A T 13: 99,411,465 probably benign Het
Mzb1 T A 18: 35,647,664 Y158F probably benign Het
Nat8l T A 5: 33,998,479 C160S probably damaging Het
Ncf4 T C 15: 78,262,393 probably benign Het
Olfr362 A T 2: 37,104,802 Y283N probably damaging Het
Olfr98 T C 17: 37,262,839 Y275C probably damaging Het
Pak2 T A 16: 32,043,118 probably benign Het
Pcdhga12 T C 18: 37,768,107 I664T probably benign Het
Pcnx2 A C 8: 125,838,010 L1048R possibly damaging Het
Pcsk5 T C 19: 17,675,585 M246V probably damaging Het
Pkd2l2 T A 18: 34,433,302 V522D probably benign Het
Plekhh1 A T 12: 79,069,106 M808L probably benign Het
Plpp2 C A 10: 79,527,139 R157L probably benign Het
Plrg1 T A 3: 83,071,251 H441Q probably benign Het
Pnpla6 T C 8: 3,522,613 V300A probably damaging Het
Ptprb A T 10: 116,348,183 K1633N possibly damaging Het
Ralgapa1 A G 12: 55,612,723 V2004A possibly damaging Het
Rasd1 G T 11: 59,964,107 S182R possibly damaging Het
Rc3h2 A T 2: 37,398,361 probably null Het
Rrp1b T A 17: 32,036,471 probably benign Het
Ruvbl1 T C 6: 88,497,290 I425T probably benign Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Slc12a2 A G 18: 57,899,272 Y348C probably damaging Het
Slc14a2 C A 18: 78,195,748 V219L possibly damaging Het
Smc1b G T 15: 85,064,984 P1242Q probably damaging Het
Snx27 T A 3: 94,524,244 D281V probably damaging Het
Spem2 C T 11: 69,817,147 V331I probably benign Het
Sptb C A 12: 76,609,278 K1343N probably damaging Het
Sult2a8 T C 7: 14,413,659 I236V probably benign Het
Syk A G 13: 52,611,035 E66G probably damaging Het
Synm T A 7: 67,735,658 E310V probably damaging Het
Tas2r118 G A 6: 23,969,210 A284V probably benign Het
Tlr11 A G 14: 50,363,121 N855D possibly damaging Het
Tmem230 G T 2: 132,245,951 probably benign Het
Trappc8 G A 18: 20,844,180 T844I probably benign Het
Trmt44 T C 5: 35,565,468 S419G possibly damaging Het
Trpv1 T A 11: 73,241,748 V396E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp2 A G 7: 140,007,441 I337T possibly damaging Het
Ubr4 T C 4: 139,410,623 I1097T probably damaging Het
Vmn2r61 T C 7: 42,300,529 F791S possibly damaging Het
Zdhhc2 T A 8: 40,445,784 M45K probably benign Het
Zfp383 T A 7: 29,914,741 D140E probably damaging Het
Zfp712 C A 13: 67,041,361 K367N probably damaging Het
Zfp763 C T 17: 33,018,975 A399T probably damaging Het
Other mutations in Mcoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mcoln1 APN 8 3507558 missense possibly damaging 0.89
IGL01621:Mcoln1 APN 8 3510910 missense probably damaging 1.00
IGL02147:Mcoln1 APN 8 3508379 missense probably benign
IGL02156:Mcoln1 APN 8 3512657 nonsense probably null
R0616:Mcoln1 UTSW 8 3515025 missense probably benign 0.00
R1498:Mcoln1 UTSW 8 3512861 missense probably damaging 1.00
R2102:Mcoln1 UTSW 8 3511731 missense probably damaging 1.00
R2155:Mcoln1 UTSW 8 3511787 missense probably damaging 1.00
R2178:Mcoln1 UTSW 8 3508766 missense probably damaging 1.00
R2218:Mcoln1 UTSW 8 3505813 missense possibly damaging 0.50
R3828:Mcoln1 UTSW 8 3500601 missense possibly damaging 0.93
R3875:Mcoln1 UTSW 8 3508355 missense probably benign
R3971:Mcoln1 UTSW 8 3507408 missense probably benign 0.01
R4621:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4622:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4659:Mcoln1 UTSW 8 3510840 missense probably damaging 1.00
R4873:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4875:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4914:Mcoln1 UTSW 8 3507483 nonsense probably null
R5586:Mcoln1 UTSW 8 3510389 missense probably damaging 1.00
R5876:Mcoln1 UTSW 8 3510910 missense probably damaging 1.00
R5946:Mcoln1 UTSW 8 3508701 missense probably damaging 1.00
R6520:Mcoln1 UTSW 8 3505855 missense probably damaging 1.00
R7449:Mcoln1 UTSW 8 3507285 missense probably damaging 0.98
R7712:Mcoln1 UTSW 8 3505873 missense probably damaging 0.99
R7904:Mcoln1 UTSW 8 3508356 missense probably benign
R7987:Mcoln1 UTSW 8 3508356 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGGGTTTCTAGACAGACCC -3'
(R):5'- TGTCAGGTAGCGAATGACACC -3'

Sequencing Primer
(F):5'- GGGTTTCTAGACAGACCCTCACC -3'
(R):5'- CGACCCAGACTAGCAGAGTG -3'
Posted On2016-06-15