Incidental Mutation 'R5114:Ptprb'
ID394099
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 042702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5114 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116348183 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1633 (K1633N)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: K1346N

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: K1346N

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218553
AA Change: K1633N

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0915 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,358 M431L probably benign Het
1700066B19Rik A G 18: 35,728,841 Y126C probably damaging Het
1810041L15Rik T C 15: 84,417,226 D72G probably damaging Het
5830454E08Rik T A 9: 120,577,627 probably benign Het
Ada G A 2: 163,730,486 R225C probably benign Het
Adamts9 T C 6: 92,890,273 K625R probably benign Het
Ano1 T C 7: 144,657,083 I182V possibly damaging Het
Aox4 T C 1: 58,246,286 V643A possibly damaging Het
Arcn1 T C 9: 44,760,144 I29V probably benign Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Asb10 A T 5: 24,540,742 L62Q probably damaging Het
Atp23 T A 10: 126,887,534 H233L possibly damaging Het
BC005561 T A 5: 104,519,876 F755I probably damaging Het
Bglap2 C T 3: 88,382,125 probably benign Het
Carnmt1 T C 19: 18,677,734 S84P probably damaging Het
Ccdc152 A G 15: 3,282,837 I180T probably damaging Het
Cdr2l T C 11: 115,393,360 F174S probably damaging Het
Celsr2 C T 3: 108,393,996 V2695I probably benign Het
Chd1 C A 17: 15,728,198 S127R probably benign Het
Chmp4c T A 3: 10,385,586 F75L probably benign Het
Col13a1 A C 10: 61,890,101 V260G possibly damaging Het
Col5a1 A G 2: 28,025,652 N183D probably damaging Het
Cpn1 C T 19: 43,986,195 V32M probably damaging Het
Cxcl1 A G 5: 90,891,514 M39V probably benign Het
Dpep2 T A 8: 105,986,193 D455V probably damaging Het
Dpp7 G A 2: 25,352,737 T441I possibly damaging Het
Dst C A 1: 34,202,559 H4001N probably damaging Het
Epg5 G A 18: 77,995,613 A1519T probably benign Het
Esrp2 C T 8: 106,132,188 V606I probably benign Het
Fbxo40 T C 16: 36,968,874 K625E probably damaging Het
Gbp2b A T 3: 142,598,185 I14F probably damaging Het
Gpr37l1 G T 1: 135,166,938 F189L probably damaging Het
Heatr5a G A 12: 51,956,237 Q161* probably null Het
Hspa4l T C 3: 40,745,765 Y30H possibly damaging Het
Hspg2 G A 4: 137,511,926 C388Y probably damaging Het
Kcna1 A G 6: 126,642,367 I330T probably damaging Het
Klhl3 T A 13: 58,018,967 Y350F probably benign Het
Kntc1 T C 5: 123,781,055 probably null Het
Krtap10-4 A T 10: 77,826,686 C109* probably null Het
Lrch4 T C 5: 137,637,917 S377P probably benign Het
Lrrc8c C A 5: 105,607,483 H375N probably damaging Het
Lsg1 T C 16: 30,561,720 E633G probably damaging Het
Mcoln1 T C 8: 3,510,697 probably benign Het
Med12l C A 3: 59,259,688 T1523K possibly damaging Het
Mrps27 A T 13: 99,411,465 probably benign Het
Mzb1 T A 18: 35,647,664 Y158F probably benign Het
Nat8l T A 5: 33,998,479 C160S probably damaging Het
Ncf4 T C 15: 78,262,393 probably benign Het
Olfr362 A T 2: 37,104,802 Y283N probably damaging Het
Olfr98 T C 17: 37,262,839 Y275C probably damaging Het
Pak2 T A 16: 32,043,118 probably benign Het
Pcdhga12 T C 18: 37,768,107 I664T probably benign Het
Pcnx2 A C 8: 125,838,010 L1048R possibly damaging Het
Pcsk5 T C 19: 17,675,585 M246V probably damaging Het
Pkd2l2 T A 18: 34,433,302 V522D probably benign Het
Plekhh1 A T 12: 79,069,106 M808L probably benign Het
Plpp2 C A 10: 79,527,139 R157L probably benign Het
Plrg1 T A 3: 83,071,251 H441Q probably benign Het
Pnpla6 T C 8: 3,522,613 V300A probably damaging Het
Ralgapa1 A G 12: 55,612,723 V2004A possibly damaging Het
Rasd1 G T 11: 59,964,107 S182R possibly damaging Het
Rc3h2 A T 2: 37,398,361 probably null Het
Rrp1b T A 17: 32,036,471 probably benign Het
Ruvbl1 T C 6: 88,497,290 I425T probably benign Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Slc12a2 A G 18: 57,899,272 Y348C probably damaging Het
Slc14a2 C A 18: 78,195,748 V219L possibly damaging Het
Smc1b G T 15: 85,064,984 P1242Q probably damaging Het
Snx27 T A 3: 94,524,244 D281V probably damaging Het
Spem2 C T 11: 69,817,147 V331I probably benign Het
Sptb C A 12: 76,609,278 K1343N probably damaging Het
Sult2a8 T C 7: 14,413,659 I236V probably benign Het
Syk A G 13: 52,611,035 E66G probably damaging Het
Synm T A 7: 67,735,658 E310V probably damaging Het
Tas2r118 G A 6: 23,969,210 A284V probably benign Het
Tlr11 A G 14: 50,363,121 N855D possibly damaging Het
Tmem230 G T 2: 132,245,951 probably benign Het
Trappc8 G A 18: 20,844,180 T844I probably benign Het
Trmt44 T C 5: 35,565,468 S419G possibly damaging Het
Trpv1 T A 11: 73,241,748 V396E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp2 A G 7: 140,007,441 I337T possibly damaging Het
Ubr4 T C 4: 139,410,623 I1097T probably damaging Het
Vmn2r61 T C 7: 42,300,529 F791S possibly damaging Het
Zdhhc2 T A 8: 40,445,784 M45K probably benign Het
Zfp383 T A 7: 29,914,741 D140E probably damaging Het
Zfp712 C A 13: 67,041,361 K367N probably damaging Het
Zfp763 C T 17: 33,018,975 A399T probably damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTTGCAAACACCTCCTTGGC -3'
(R):5'- TGCTGTTAGCTGAATGAATGC -3'

Sequencing Primer
(F):5'- TCCTTGGCTATCACCTGGAAGG -3'
(R):5'- TGTTAGCTGAATGAATGCAAAGAGTC -3'
Posted On2016-06-15