Mutagenetix > Incidental Mutations

Incidental Mutation 'R5114:Ptprb'

394099

Institutional Source

Beutler Lab

Gene Symbol

Ptprb

Ensembl Gene

ENSMUSG00000020154

Gene Name

protein tyrosine phosphatase, receptor type, B

Synonyms

3230402H02Rik, VE-PTP

MMRRC Submission

042702-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5114 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116275523-116389535 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 116348183 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1633 (K1633N)

Ref Sequence

ENSEMBL: ENSMUSP00000151821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]

Predicted Effect

probably benign
Transcript: ENSMUST00000092167
AA Change: K1346N

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: K1346N

Domain	Start	End	E-Value	Type
FN3	22	102	8.23e1	SMART
FN3	111	193	1.73e-5	SMART
FN3	204	281	1.56e-3	SMART
FN3	290	366	6.45e-5	SMART
FN3	378	459	5e-2	SMART
FN3	468	546	1.61e-5	SMART
FN3	555	632	7.18e-3	SMART
FN3	644	724	7.52e-6	SMART
FN3	732	811	2.92e-3	SMART
FN3	820	899	2.76e-4	SMART
FN3	908	987	1.29e-4	SMART
FN3	996	1075	7.7e-3	SMART
FN3	1086	1166	1.21e0	SMART
FN3	1174	1253	5.08e-3	SMART
FN3	1262	1340	1.17e-7	SMART
FN3	1356	1435	2.68e-2	SMART
Blast:FN3	1450	1591	6e-88	BLAST
transmembrane domain	1620	1642	N/A	INTRINSIC
Blast:PTPc	1643	1681	3e-11	BLAST
PTPc	1703	1966	1.05e-134	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218553
AA Change: K1633N

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.0915

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,931,358	M431L	probably benign	Het
1700066B19Rik	A	G	18: 35,728,841	Y126C	probably damaging	Het
1810041L15Rik	T	C	15: 84,417,226	D72G	probably damaging	Het
5830454E08Rik	T	A	9: 120,577,627		probably benign	Het
Ada	G	A	2: 163,730,486	R225C	probably benign	Het
Adamts9	T	C	6: 92,890,273	K625R	probably benign	Het
Ano1	T	C	7: 144,657,083	I182V	possibly damaging	Het
Aox4	T	C	1: 58,246,286	V643A	possibly damaging	Het
Arcn1	T	C	9: 44,760,144	I29V	probably benign	Het
Arhgap15	A	G	2: 43,780,618	T5A	probably benign	Het
Asb10	A	T	5: 24,540,742	L62Q	probably damaging	Het
Atp23	T	A	10: 126,887,534	H233L	possibly damaging	Het
BC005561	T	A	5: 104,519,876	F755I	probably damaging	Het
Bglap2	C	T	3: 88,382,125		probably benign	Het
Carnmt1	T	C	19: 18,677,734	S84P	probably damaging	Het
Ccdc152	A	G	15: 3,282,837	I180T	probably damaging	Het
Cdr2l	T	C	11: 115,393,360	F174S	probably damaging	Het
Celsr2	C	T	3: 108,393,996	V2695I	probably benign	Het
Chd1	C	A	17: 15,728,198	S127R	probably benign	Het
Chmp4c	T	A	3: 10,385,586	F75L	probably benign	Het
Col13a1	A	C	10: 61,890,101	V260G	possibly damaging	Het
Col5a1	A	G	2: 28,025,652	N183D	probably damaging	Het
Cpn1	C	T	19: 43,986,195	V32M	probably damaging	Het
Cxcl1	A	G	5: 90,891,514	M39V	probably benign	Het
Dpep2	T	A	8: 105,986,193	D455V	probably damaging	Het
Dpp7	G	A	2: 25,352,737	T441I	possibly damaging	Het
Dst	C	A	1: 34,202,559	H4001N	probably damaging	Het
Epg5	G	A	18: 77,995,613	A1519T	probably benign	Het
Esrp2	C	T	8: 106,132,188	V606I	probably benign	Het
Fbxo40	T	C	16: 36,968,874	K625E	probably damaging	Het
Gbp2b	A	T	3: 142,598,185	I14F	probably damaging	Het
Gpr37l1	G	T	1: 135,166,938	F189L	probably damaging	Het
Heatr5a	G	A	12: 51,956,237	Q161*	probably null	Het
Hspa4l	T	C	3: 40,745,765	Y30H	possibly damaging	Het
Hspg2	G	A	4: 137,511,926	C388Y	probably damaging	Het
Kcna1	A	G	6: 126,642,367	I330T	probably damaging	Het
Klhl3	T	A	13: 58,018,967	Y350F	probably benign	Het
Kntc1	T	C	5: 123,781,055		probably null	Het
Krtap10-4	A	T	10: 77,826,686	C109*	probably null	Het
Lrch4	T	C	5: 137,637,917	S377P	probably benign	Het
Lrrc8c	C	A	5: 105,607,483	H375N	probably damaging	Het
Lsg1	T	C	16: 30,561,720	E633G	probably damaging	Het
Mcoln1	T	C	8: 3,510,697		probably benign	Het
Med12l	C	A	3: 59,259,688	T1523K	possibly damaging	Het
Mrps27	A	T	13: 99,411,465		probably benign	Het
Mzb1	T	A	18: 35,647,664	Y158F	probably benign	Het
Nat8l	T	A	5: 33,998,479	C160S	probably damaging	Het
Ncf4	T	C	15: 78,262,393		probably benign	Het
Olfr362	A	T	2: 37,104,802	Y283N	probably damaging	Het
Olfr98	T	C	17: 37,262,839	Y275C	probably damaging	Het
Pak2	T	A	16: 32,043,118		probably benign	Het
Pcdhga12	T	C	18: 37,768,107	I664T	probably benign	Het
Pcnx2	A	C	8: 125,838,010	L1048R	possibly damaging	Het
Pcsk5	T	C	19: 17,675,585	M246V	probably damaging	Het
Pkd2l2	T	A	18: 34,433,302	V522D	probably benign	Het
Plekhh1	A	T	12: 79,069,106	M808L	probably benign	Het
Plpp2	C	A	10: 79,527,139	R157L	probably benign	Het
Plrg1	T	A	3: 83,071,251	H441Q	probably benign	Het
Pnpla6	T	C	8: 3,522,613	V300A	probably damaging	Het
Ralgapa1	A	G	12: 55,612,723	V2004A	possibly damaging	Het
Rasd1	G	T	11: 59,964,107	S182R	possibly damaging	Het
Rc3h2	A	T	2: 37,398,361		probably null	Het
Rrp1b	T	A	17: 32,036,471		probably benign	Het
Ruvbl1	T	C	6: 88,497,290	I425T	probably benign	Het
Sipa1l1	C	T	12: 82,440,908	A1652V	probably benign	Het
Slc12a2	A	G	18: 57,899,272	Y348C	probably damaging	Het
Slc14a2	C	A	18: 78,195,748	V219L	possibly damaging	Het
Smc1b	G	T	15: 85,064,984	P1242Q	probably damaging	Het
Snx27	T	A	3: 94,524,244	D281V	probably damaging	Het
Spem2	C	T	11: 69,817,147	V331I	probably benign	Het
Sptb	C	A	12: 76,609,278	K1343N	probably damaging	Het
Sult2a8	T	C	7: 14,413,659	I236V	probably benign	Het
Syk	A	G	13: 52,611,035	E66G	probably damaging	Het
Synm	T	A	7: 67,735,658	E310V	probably damaging	Het
Tas2r118	G	A	6: 23,969,210	A284V	probably benign	Het
Tlr11	A	G	14: 50,363,121	N855D	possibly damaging	Het
Tmem230	G	T	2: 132,245,951		probably benign	Het
Trappc8	G	A	18: 20,844,180	T844I	probably benign	Het
Trmt44	T	C	5: 35,565,468	S419G	possibly damaging	Het
Trpv1	T	A	11: 73,241,748	V396E	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubgcp2	A	G	7: 140,007,441	I337T	possibly damaging	Het
Ubr4	T	C	4: 139,410,623	I1097T	probably damaging	Het
Vmn2r61	T	C	7: 42,300,529	F791S	possibly damaging	Het
Zdhhc2	T	A	8: 40,445,784	M45K	probably benign	Het
Zfp383	T	A	7: 29,914,741	D140E	probably damaging	Het
Zfp712	C	A	13: 67,041,361	K367N	probably damaging	Het
Zfp763	C	T	17: 33,018,975	A399T	probably damaging	Het

Other mutations in Ptprb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Ptprb	APN	10	116362648	missense	probably benign	0.15
IGL01354:Ptprb	APN	10	116343891	missense	probably benign	0.24
IGL01404:Ptprb	APN	10	116339436	missense	probably benign	0.14
IGL01410:Ptprb	APN	10	116302274	missense	possibly damaging	0.60
IGL01412:Ptprb	APN	10	116343915	missense	probably benign	0.27
IGL01731:Ptprb	APN	10	116372876	missense	probably damaging	1.00
IGL02003:Ptprb	APN	10	116367505	missense	probably damaging	1.00
IGL02110:Ptprb	APN	10	116331203	splice site	probably benign
IGL02178:Ptprb	APN	10	116322532	missense	probably benign	0.00
IGL02304:Ptprb	APN	10	116331259	missense	probably damaging	1.00
IGL02324:Ptprb	APN	10	116319333	missense	probably benign	0.03
IGL02388:Ptprb	APN	10	116367521	missense	probably damaging	1.00
IGL02640:Ptprb	APN	10	116338664	missense	probably damaging	0.99
IGL02698:Ptprb	APN	10	116363280	missense	probably benign	0.05
IGL02876:Ptprb	APN	10	116348211	splice site	probably benign
IGL02879:Ptprb	APN	10	116327968	missense	probably benign
IGL02982:Ptprb	APN	10	116322628	missense	probably benign	0.20
IGL03146:Ptprb	APN	10	116328127	missense	probably benign	0.14
IGL03351:Ptprb	APN	10	116339582	missense	probably benign	0.03
R0306:Ptprb	UTSW	10	116343988	missense	probably benign	0.04
R0385:Ptprb	UTSW	10	116350178	missense	probably benign	0.00
R0600:Ptprb	UTSW	10	116368807	missense	possibly damaging	0.63
R0613:Ptprb	UTSW	10	116302325	missense	possibly damaging	0.59
R0613:Ptprb	UTSW	10	116302378	missense	possibly damaging	0.87
R0850:Ptprb	UTSW	10	116302125	missense	possibly damaging	0.87
R0850:Ptprb	UTSW	10	116339510	missense	probably damaging	1.00
R1331:Ptprb	UTSW	10	116367532	missense	probably damaging	1.00
R1413:Ptprb	UTSW	10	116339679	missense	probably damaging	1.00
R1418:Ptprb	UTSW	10	116319470	missense	probably benign	0.00
R1545:Ptprb	UTSW	10	116380869	missense	probably damaging	1.00
R1562:Ptprb	UTSW	10	116339467	missense	probably benign	0.00
R1752:Ptprb	UTSW	10	116340990	missense	probably benign	0.44
R1837:Ptprb	UTSW	10	116341626	missense	probably benign	0.00
R1940:Ptprb	UTSW	10	116319610	splice site	probably benign
R1958:Ptprb	UTSW	10	116341536	missense	probably benign	0.10
R2029:Ptprb	UTSW	10	116347053	missense	probably benign	0.37
R2031:Ptprb	UTSW	10	116317543	missense	probably benign
R2101:Ptprb	UTSW	10	116315038	splice site	probably benign
R2209:Ptprb	UTSW	10	116369357	missense	probably damaging	1.00
R3016:Ptprb	UTSW	10	116357295	missense	possibly damaging	0.64
R3076:Ptprb	UTSW	10	116344026	missense	probably damaging	0.99
R3821:Ptprb	UTSW	10	116350074	missense	probably benign	0.11
R3824:Ptprb	UTSW	10	116350789	missense	probably benign	0.05
R3825:Ptprb	UTSW	10	116350789	missense	probably benign	0.05
R3841:Ptprb	UTSW	10	116346982	missense	possibly damaging	0.79
R3953:Ptprb	UTSW	10	116341494	missense	probably benign	0.00
R4125:Ptprb	UTSW	10	116353849	missense	probably benign	0.12
R4227:Ptprb	UTSW	10	116302225	missense	possibly damaging	0.96
R4385:Ptprb	UTSW	10	116346867	missense	probably benign
R4731:Ptprb	UTSW	10	116319333	missense	probably benign	0.03
R5009:Ptprb	UTSW	10	116348127	missense	possibly damaging	0.61
R5104:Ptprb	UTSW	10	116322459	missense	probably benign	0.17
R5145:Ptprb	UTSW	10	116343915	missense	probably benign	0.27
R5214:Ptprb	UTSW	10	116369324	missense	possibly damaging	0.75
R5382:Ptprb	UTSW	10	116353871	missense	probably damaging	1.00
R5553:Ptprb	UTSW	10	116350185	missense	probably damaging	1.00
R5585:Ptprb	UTSW	10	116380854	missense	probably damaging	0.98
R5586:Ptprb	UTSW	10	116353827	missense	probably damaging	1.00
R5808:Ptprb	UTSW	10	116339487	missense	probably benign	0.00
R5875:Ptprb	UTSW	10	116348166	missense	probably benign	0.00
R6051:Ptprb	UTSW	10	116341090	nonsense	probably null
R6383:Ptprb	UTSW	10	116347007	nonsense	probably null
R6511:Ptprb	UTSW	10	116346820	missense	probably damaging	1.00
R6817:Ptprb	UTSW	10	116283677	small deletion	probably benign
R6826:Ptprb	UTSW	10	116317372	missense	probably benign	0.26
R6958:Ptprb	UTSW	10	116277248	missense	probably benign	0.32
R7103:Ptprb	UTSW	10	116338813	missense	probably damaging	1.00
R7129:Ptprb	UTSW	10	116283677	small deletion	probably benign
R7181:Ptprb	UTSW	10	116368766	missense	probably damaging	1.00
R7215:Ptprb	UTSW	10	116338776	missense	possibly damaging	0.94
R7289:Ptprb	UTSW	10	116328165	missense	probably damaging	0.99
R7315:Ptprb	UTSW	10	116362379	missense	possibly damaging	0.83
R7319:Ptprb	UTSW	10	116341404	missense	probably benign	0.01
R7381:Ptprb	UTSW	10	116341133	missense	probably benign
R7412:Ptprb	UTSW	10	116341138	missense	probably benign
R7483:Ptprb	UTSW	10	116283429	missense	probably benign	0.01
R7495:Ptprb	UTSW	10	116341448	missense	probably benign	0.12
R7508:Ptprb	UTSW	10	116353991	nonsense	probably null
R7571:Ptprb	UTSW	10	116339430	missense	probably damaging	1.00
R7586:Ptprb	UTSW	10	116343874	missense	probably damaging	0.97
R7623:Ptprb	UTSW	10	116369309	missense	possibly damaging	0.63
R7694:Ptprb	UTSW	10	116372948	missense	probably damaging	1.00
R7744:Ptprb	UTSW	10	116277484	missense	probably benign	0.10
R7752:Ptprb	UTSW	10	116369428	missense	probably benign	0.37
R7826:Ptprb	UTSW	10	116283677	small deletion	probably benign
RF041:Ptprb	UTSW	10	116283677	small deletion	probably benign
X0020:Ptprb	UTSW	10	116302180	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GTTGCAAACACCTCCTTGGC -3'
(R):5'- TGCTGTTAGCTGAATGAATGC -3'

Sequencing Primer
(F):5'- TCCTTGGCTATCACCTGGAAGG -3'
(R):5'- TGTTAGCTGAATGAATGCAAAGAGTC -3'

Posted On

2016-06-15