Incidental Mutation 'R5114:Sptb'
ID394107
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
MMRRC Submission 042702-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R5114 (G1)
Quality Score202
Status Validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76609278 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1343 (K1343N)
Ref Sequence ENSEMBL: ENSMUSP00000129782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]
Predicted Effect probably damaging
Transcript: ENSMUST00000021458
AA Change: K1343N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: K1343N

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166101
AA Change: K1343N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: K1343N

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.87e-11 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2117 1.16e-9 SMART
Meta Mutation Damage Score 0.3484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,358 M431L probably benign Het
1700066B19Rik A G 18: 35,728,841 Y126C probably damaging Het
1810041L15Rik T C 15: 84,417,226 D72G probably damaging Het
5830454E08Rik T A 9: 120,577,627 probably benign Het
Ada G A 2: 163,730,486 R225C probably benign Het
Adamts9 T C 6: 92,890,273 K625R probably benign Het
Ano1 T C 7: 144,657,083 I182V possibly damaging Het
Aox4 T C 1: 58,246,286 V643A possibly damaging Het
Arcn1 T C 9: 44,760,144 I29V probably benign Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Asb10 A T 5: 24,540,742 L62Q probably damaging Het
Atp23 T A 10: 126,887,534 H233L possibly damaging Het
BC005561 T A 5: 104,519,876 F755I probably damaging Het
Bglap2 C T 3: 88,382,125 probably benign Het
Carnmt1 T C 19: 18,677,734 S84P probably damaging Het
Ccdc152 A G 15: 3,282,837 I180T probably damaging Het
Cdr2l T C 11: 115,393,360 F174S probably damaging Het
Celsr2 C T 3: 108,393,996 V2695I probably benign Het
Chd1 C A 17: 15,728,198 S127R probably benign Het
Chmp4c T A 3: 10,385,586 F75L probably benign Het
Col13a1 A C 10: 61,890,101 V260G possibly damaging Het
Col5a1 A G 2: 28,025,652 N183D probably damaging Het
Cpn1 C T 19: 43,986,195 V32M probably damaging Het
Cxcl1 A G 5: 90,891,514 M39V probably benign Het
Dpep2 T A 8: 105,986,193 D455V probably damaging Het
Dpp7 G A 2: 25,352,737 T441I possibly damaging Het
Dst C A 1: 34,202,559 H4001N probably damaging Het
Epg5 G A 18: 77,995,613 A1519T probably benign Het
Esrp2 C T 8: 106,132,188 V606I probably benign Het
Fbxo40 T C 16: 36,968,874 K625E probably damaging Het
Gbp2b A T 3: 142,598,185 I14F probably damaging Het
Gpr37l1 G T 1: 135,166,938 F189L probably damaging Het
Heatr5a G A 12: 51,956,237 Q161* probably null Het
Hspa4l T C 3: 40,745,765 Y30H possibly damaging Het
Hspg2 G A 4: 137,511,926 C388Y probably damaging Het
Kcna1 A G 6: 126,642,367 I330T probably damaging Het
Klhl3 T A 13: 58,018,967 Y350F probably benign Het
Kntc1 T C 5: 123,781,055 probably null Het
Krtap10-4 A T 10: 77,826,686 C109* probably null Het
Lrch4 T C 5: 137,637,917 S377P probably benign Het
Lrrc8c C A 5: 105,607,483 H375N probably damaging Het
Lsg1 T C 16: 30,561,720 E633G probably damaging Het
Mcoln1 T C 8: 3,510,697 probably benign Het
Med12l C A 3: 59,259,688 T1523K possibly damaging Het
Mrps27 A T 13: 99,411,465 probably benign Het
Mzb1 T A 18: 35,647,664 Y158F probably benign Het
Nat8l T A 5: 33,998,479 C160S probably damaging Het
Ncf4 T C 15: 78,262,393 probably benign Het
Olfr362 A T 2: 37,104,802 Y283N probably damaging Het
Olfr98 T C 17: 37,262,839 Y275C probably damaging Het
Pak2 T A 16: 32,043,118 probably benign Het
Pcdhga12 T C 18: 37,768,107 I664T probably benign Het
Pcnx2 A C 8: 125,838,010 L1048R possibly damaging Het
Pcsk5 T C 19: 17,675,585 M246V probably damaging Het
Pkd2l2 T A 18: 34,433,302 V522D probably benign Het
Plekhh1 A T 12: 79,069,106 M808L probably benign Het
Plpp2 C A 10: 79,527,139 R157L probably benign Het
Plrg1 T A 3: 83,071,251 H441Q probably benign Het
Pnpla6 T C 8: 3,522,613 V300A probably damaging Het
Ptprb A T 10: 116,348,183 K1633N possibly damaging Het
Ralgapa1 A G 12: 55,612,723 V2004A possibly damaging Het
Rasd1 G T 11: 59,964,107 S182R possibly damaging Het
Rc3h2 A T 2: 37,398,361 probably null Het
Rrp1b T A 17: 32,036,471 probably benign Het
Ruvbl1 T C 6: 88,497,290 I425T probably benign Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Slc12a2 A G 18: 57,899,272 Y348C probably damaging Het
Slc14a2 C A 18: 78,195,748 V219L possibly damaging Het
Smc1b G T 15: 85,064,984 P1242Q probably damaging Het
Snx27 T A 3: 94,524,244 D281V probably damaging Het
Spem2 C T 11: 69,817,147 V331I probably benign Het
Sult2a8 T C 7: 14,413,659 I236V probably benign Het
Syk A G 13: 52,611,035 E66G probably damaging Het
Synm T A 7: 67,735,658 E310V probably damaging Het
Tas2r118 G A 6: 23,969,210 A284V probably benign Het
Tlr11 A G 14: 50,363,121 N855D possibly damaging Het
Tmem230 G T 2: 132,245,951 probably benign Het
Trappc8 G A 18: 20,844,180 T844I probably benign Het
Trmt44 T C 5: 35,565,468 S419G possibly damaging Het
Trpv1 T A 11: 73,241,748 V396E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp2 A G 7: 140,007,441 I337T possibly damaging Het
Ubr4 T C 4: 139,410,623 I1097T probably damaging Het
Vmn2r61 T C 7: 42,300,529 F791S possibly damaging Het
Zdhhc2 T A 8: 40,445,784 M45K probably benign Het
Zfp383 T A 7: 29,914,741 D140E probably damaging Het
Zfp712 C A 13: 67,041,361 K367N probably damaging Het
Zfp763 C T 17: 33,018,975 A399T probably damaging Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556 unclassified probably benign
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
PIT4472001:Sptb UTSW 12 76620686 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1668:Sptb UTSW 12 76621169 missense probably benign
R1677:Sptb UTSW 12 76629649 missense probably damaging 1.00
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2011:Sptb UTSW 12 76632472 missense possibly damaging 0.95
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4619:Sptb UTSW 12 76583807 nonsense probably null
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5191:Sptb UTSW 12 76612834 missense probably benign 0.12
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5725:Sptb UTSW 12 76623114 missense probably benign 0.25
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5797:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
R7023:Sptb UTSW 12 76625088 missense probably damaging 1.00
R7366:Sptb UTSW 12 76604194 missense probably damaging 1.00
R7379:Sptb UTSW 12 76610877 missense probably damaging 1.00
R7389:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7392:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7477:Sptb UTSW 12 76628565 missense probably damaging 1.00
R7653:Sptb UTSW 12 76628497 missense probably benign 0.06
R7684:Sptb UTSW 12 76612195 missense probably benign 0.06
R7733:Sptb UTSW 12 76597921 intron probably null
R7846:Sptb UTSW 12 76608526 nonsense probably null
R7929:Sptb UTSW 12 76608526 nonsense probably null
R8048:Sptb UTSW 12 76628559 missense probably benign 0.02
X0057:Sptb UTSW 12 76630739 missense probably benign
Z1176:Sptb UTSW 12 76620733 nonsense probably null
Z1177:Sptb UTSW 12 76583584 missense probably damaging 1.00
Z1177:Sptb UTSW 12 76606445 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CCATGGCACCGATCCATTTG -3'
(R):5'- TGAATCATTTGTCCAAACACTGCTC -3'

Sequencing Primer
(F):5'- CATGGCACCGATCCATTTGTTAAGG -3'
(R):5'- CCCCCATCTGTAGATAACTTTAGAGG -3'
Posted On2016-06-15