Incidental Mutation 'R0446:Ubr2'
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Nameubiquitin protein ligase E3 component n-recognin 2
Synonyms9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosomal Location46928295-47010556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46983298 bp
Amino Acid Change Methionine to Lysine at position 303 (M303K)
Ref Sequence ENSEMBL: ENSMUSP00000108963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]
Predicted Effect probably damaging
Transcript: ENSMUST00000113335
AA Change: M303K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: M303K

ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113337
AA Change: M303K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: M303K

ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224759
Predicted Effect probably benign
Transcript: ENSMUST00000225599
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 46986060 splice site probably benign
IGL00332:Ubr2 APN 17 46990990 critical splice donor site probably null
IGL00518:Ubr2 APN 17 46992996 missense probably damaging 1.00
IGL00693:Ubr2 APN 17 46972981 missense probably benign 0.01
IGL00785:Ubr2 APN 17 46944865 missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 46957321 missense probably damaging 1.00
IGL01459:Ubr2 APN 17 46930509 splice site probably benign
IGL01637:Ubr2 APN 17 46956654 missense probably damaging 1.00
IGL01710:Ubr2 APN 17 46943409 missense probably benign 0.00
IGL01726:Ubr2 APN 17 46992981 splice site probably benign
IGL01925:Ubr2 APN 17 46954949 missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 46973967 missense probably benign 0.45
IGL02170:Ubr2 APN 17 46967197 missense probably benign 0.05
IGL02308:Ubr2 APN 17 46934193 missense probably damaging 1.00
IGL02387:Ubr2 APN 17 46963150 missense probably benign
IGL02696:Ubr2 APN 17 46963765 missense probably benign
IGL02726:Ubr2 APN 17 46972921 missense probably damaging 1.00
IGL02750:Ubr2 APN 17 46969282 missense probably benign 0.00
IGL02934:Ubr2 APN 17 46957340 missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 46975951 missense probably damaging 0.96
IGL03018:Ubr2 APN 17 46954046 missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 46951918 missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 46944863 missense probably damaging 1.00
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0513:Ubr2 UTSW 17 46986779 nonsense probably null
R0565:Ubr2 UTSW 17 46955886 missense probably damaging 1.00
R0600:Ubr2 UTSW 17 46967248 missense probably damaging 0.99
R0690:Ubr2 UTSW 17 46938653 missense probably damaging 0.97
R0710:Ubr2 UTSW 17 46938681 missense probably damaging 0.96
R0761:Ubr2 UTSW 17 46983316 missense probably damaging 1.00
R0798:Ubr2 UTSW 17 46969176 splice site probably benign
R0862:Ubr2 UTSW 17 46967083 nonsense probably null
R0947:Ubr2 UTSW 17 46941112 missense probably damaging 0.99
R0972:Ubr2 UTSW 17 46934261 splice site probably null
R1500:Ubr2 UTSW 17 46986689 missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47000823 missense probably damaging 1.00
R1533:Ubr2 UTSW 17 46967247 nonsense probably null
R1554:Ubr2 UTSW 17 46972951 missense probably benign
R1575:Ubr2 UTSW 17 46932492 missense probably damaging 1.00
R1602:Ubr2 UTSW 17 46941061 missense probably benign 0.30
R1941:Ubr2 UTSW 17 46974026 missense probably damaging 1.00
R1966:Ubr2 UTSW 17 46954919 missense probably benign 0.05
R2041:Ubr2 UTSW 17 46986047 missense probably damaging 1.00
R2067:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2111:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2189:Ubr2 UTSW 17 46943364 missense probably benign 0.01
R2219:Ubr2 UTSW 17 46986042 missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 46966215 nonsense probably null
R3426:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3428:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3608:Ubr2 UTSW 17 46944523 missense probably damaging 1.00
R4080:Ubr2 UTSW 17 46988722 missense probably benign 0.05
R4330:Ubr2 UTSW 17 46967278 missense probably null 1.00
R4383:Ubr2 UTSW 17 46939387 missense probably benign 0.01
R4460:Ubr2 UTSW 17 46945045 critical splice donor site probably null
R4794:Ubr2 UTSW 17 46930445 missense probably damaging 1.00
R4902:Ubr2 UTSW 17 46985996 missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 46959459 splice site probably null
R5092:Ubr2 UTSW 17 46969247 missense probably damaging 1.00
R5209:Ubr2 UTSW 17 46968424 missense probably damaging 1.00
R5226:Ubr2 UTSW 17 46983270 missense probably benign 0.04
R5250:Ubr2 UTSW 17 46930442 missense probably benign 0.01
R5437:Ubr2 UTSW 17 46963697 missense probably benign 0.00
R5607:Ubr2 UTSW 17 46934200 nonsense probably null
R5848:Ubr2 UTSW 17 46956655 missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 46982292 missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 46957315 missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 46966268 splice site probably null
R6630:Ubr2 UTSW 17 46951984 missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 46934108 missense probably damaging 0.99
R6936:Ubr2 UTSW 17 46973031 missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47010213 missense probably benign 0.01
R7050:Ubr2 UTSW 17 46961602 missense probably benign 0.30
R7078:Ubr2 UTSW 17 46955853 missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 46974056 splice site probably null
R7219:Ubr2 UTSW 17 46935434 nonsense probably null
R7262:Ubr2 UTSW 17 47000739 missense probably damaging 0.97
R7352:Ubr2 UTSW 17 46930426 missense probably benign 0.19
R7366:Ubr2 UTSW 17 46955845 missense probably damaging 0.99
R7449:Ubr2 UTSW 17 46964788 missense probably damaging 1.00
R7496:Ubr2 UTSW 17 46990991 critical splice donor site probably null
R7759:Ubr2 UTSW 17 46986048 missense probably damaging 1.00
R7869:Ubr2 UTSW 17 46991008 missense probably benign 0.00
R7916:Ubr2 UTSW 17 46968382 critical splice donor site probably null
R8236:Ubr2 UTSW 17 46951909 missense probably benign
R8376:Ubr2 UTSW 17 46942795 missense probably benign 0.07
X0027:Ubr2 UTSW 17 47000629 missense probably damaging 0.99
X0061:Ubr2 UTSW 17 46970111 missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 46959509 missense probably benign
Z1177:Ubr2 UTSW 17 47000766 missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47010143 missense probably benign 0.33
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcctctgatgctctcttctg -3'
Posted On2013-05-23