Incidental Mutation 'R5115:Ttll9'
ID394141
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
MMRRC Submission 042703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5115 (G1)
Quality Score220
Status Validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 152989590 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
Predicted Effect probably benign
Transcript: ENSMUST00000099197
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103155
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109801
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130021
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151641
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 C T 11: 54,340,498 probably null Het
Asic1 C T 15: 99,672,052 L85F probably damaging Het
Atic G A 1: 71,557,275 probably null Het
Atp1b2 T C 11: 69,603,473 T65A probably damaging Het
C2cd6 T A 1: 59,051,261 I446L probably benign Het
Cep83 A G 10: 94,768,889 H488R probably benign Het
Cwc15 A G 9: 14,507,896 I163V probably benign Het
Cyp11b2 A T 15: 74,855,428 probably null Het
Fat2 A G 11: 55,296,333 V1229A probably damaging Het
Fbn1 T C 2: 125,332,383 D1851G probably damaging Het
Golga7 A T 8: 23,245,970 probably null Het
Gsdmc2 A T 15: 63,827,768 H270Q probably benign Het
Kdm4a G T 4: 118,162,581 P326Q possibly damaging Het
Kng1 G A 16: 23,069,282 R209H possibly damaging Het
Mfn1 T C 3: 32,564,307 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Nlrc5 G A 8: 94,476,819 V516I possibly damaging Het
Nrbp1 T G 5: 31,243,715 Y96* probably null Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pikfyve T C 1: 65,224,117 probably benign Het
Plin1 AGGCCACCAGGGGGTGGGC AGGC 7: 79,729,944 probably benign Het
Prkdc A G 16: 15,790,580 Q3082R probably benign Het
Rbfox1 A G 16: 7,409,772 S405G probably damaging Het
Recql T C 6: 142,358,559 probably benign Het
Serpina3c T C 12: 104,147,392 E365G probably damaging Het
Slc17a5 A G 9: 78,577,112 V122A probably benign Het
Sprr2b G T 3: 92,317,555 C36F unknown Het
Stk36 T C 1: 74,635,827 I1307T probably damaging Het
Tmc6 G A 11: 117,775,188 T300I probably damaging Het
Vmn1r71 T A 7: 10,747,958 M202L probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
BB001:Ttll9 UTSW 2 152962487 unclassified probably benign
BB011:Ttll9 UTSW 2 152962487 unclassified probably benign
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0319:Ttll9 UTSW 2 153000098 splice site probably null
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152984145 missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4539:Ttll9 UTSW 2 152994091 missense probably damaging 1.00
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152991652 missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152984314 missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6366:Ttll9 UTSW 2 152991605 missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
R7804:Ttll9 UTSW 2 153002358 critical splice donor site probably null
R7862:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7924:Ttll9 UTSW 2 152962487 unclassified probably benign
R7998:Ttll9 UTSW 2 152991626 missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 153003036 missense possibly damaging 0.62
R8367:Ttll9 UTSW 2 152994148 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAATCACCCATGGCAAGG -3'
(R):5'- AGGATTTGAACCCAGACCTG -3'

Sequencing Primer
(F):5'- TGATTCCAGTATTAGCCGATGC -3'
(R):5'- AGACCTGGCACTCTTGTGG -3'
Posted On2016-06-15