Incidental Mutation 'R5115:Vmn1r71'
ID394148
Institutional Source Beutler Lab
Gene Symbol Vmn1r71
Ensembl Gene ENSMUSG00000059206
Gene Namevomeronasal 1 receptor 71
SynonymsV1re13
MMRRC Submission 042703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R5115 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10744543-10754364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10747958 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 202 (M202L)
Ref Sequence ENSEMBL: ENSMUSP00000153870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079113] [ENSMUST00000226874] [ENSMUST00000227003] [ENSMUST00000227702] [ENSMUST00000227940] [ENSMUST00000228098] [ENSMUST00000228248] [ENSMUST00000228374] [ENSMUST00000228526] [ENSMUST00000228561]
Predicted Effect probably benign
Transcript: ENSMUST00000079113
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078116
Gene: ENSMUSG00000059206
AA Change: M268L

DomainStartEndE-ValueType
Pfam:TAS2R 3 304 2e-8 PFAM
Pfam:7tm_1 22 289 3.1e-6 PFAM
Pfam:V1R 34 297 4.8e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210233
Predicted Effect probably benign
Transcript: ENSMUST00000226874
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000227003
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000227702
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000227940
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228098
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228248
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228374
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228526
AA Change: M268L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228561
AA Change: M202L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 C T 11: 54,340,498 probably null Het
Asic1 C T 15: 99,672,052 L85F probably damaging Het
Atic G A 1: 71,557,275 probably null Het
Atp1b2 T C 11: 69,603,473 T65A probably damaging Het
C2cd6 T A 1: 59,051,261 I446L probably benign Het
Cep83 A G 10: 94,768,889 H488R probably benign Het
Cwc15 A G 9: 14,507,896 I163V probably benign Het
Cyp11b2 A T 15: 74,855,428 probably null Het
Fat2 A G 11: 55,296,333 V1229A probably damaging Het
Fbn1 T C 2: 125,332,383 D1851G probably damaging Het
Golga7 A T 8: 23,245,970 probably null Het
Gsdmc2 A T 15: 63,827,768 H270Q probably benign Het
Kdm4a G T 4: 118,162,581 P326Q possibly damaging Het
Kng1 G A 16: 23,069,282 R209H possibly damaging Het
Mfn1 T C 3: 32,564,307 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Nlrc5 G A 8: 94,476,819 V516I possibly damaging Het
Nrbp1 T G 5: 31,243,715 Y96* probably null Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pikfyve T C 1: 65,224,117 probably benign Het
Plin1 AGGCCACCAGGGGGTGGGC AGGC 7: 79,729,944 probably benign Het
Prkdc A G 16: 15,790,580 Q3082R probably benign Het
Rbfox1 A G 16: 7,409,772 S405G probably damaging Het
Recql T C 6: 142,358,559 probably benign Het
Serpina3c T C 12: 104,147,392 E365G probably damaging Het
Slc17a5 A G 9: 78,577,112 V122A probably benign Het
Sprr2b G T 3: 92,317,555 C36F unknown Het
Stk36 T C 1: 74,635,827 I1307T probably damaging Het
Tmc6 G A 11: 117,775,188 T300I probably damaging Het
Ttll9 C A 2: 152,989,590 probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Vmn1r71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Vmn1r71 APN 7 10748119 missense probably damaging 0.99
IGL01921:Vmn1r71 APN 7 10748272 missense probably benign 0.16
IGL02397:Vmn1r71 APN 7 10748272 missense probably benign 0.27
IGL02654:Vmn1r71 APN 7 10748315 missense probably benign 0.42
IGL02900:Vmn1r71 APN 7 10748674 missense probably benign 0.28
IGL03236:Vmn1r71 APN 7 10748284 missense probably benign 0.11
IGL03269:Vmn1r71 APN 7 10748644 missense possibly damaging 0.88
FR4976:Vmn1r71 UTSW 7 10748121 missense probably benign
R0389:Vmn1r71 UTSW 7 10748311 missense probably benign 0.05
R0443:Vmn1r71 UTSW 7 10748311 missense probably benign 0.05
R0470:Vmn1r71 UTSW 7 10748092 missense possibly damaging 0.64
R0471:Vmn1r71 UTSW 7 10748092 missense possibly damaging 0.64
R0472:Vmn1r71 UTSW 7 10748092 missense possibly damaging 0.64
R0567:Vmn1r71 UTSW 7 10748629 missense probably damaging 1.00
R1498:Vmn1r71 UTSW 7 10748648 missense probably benign 0.01
R1745:Vmn1r71 UTSW 7 10748269 missense probably benign 0.05
R2350:Vmn1r71 UTSW 7 10747919 missense probably benign 0.00
R2970:Vmn1r71 UTSW 7 10748714 missense possibly damaging 0.67
R3522:Vmn1r71 UTSW 7 10747865 missense probably benign 0.03
R4193:Vmn1r71 UTSW 7 10748248 missense possibly damaging 0.55
R4736:Vmn1r71 UTSW 7 10747864 missense possibly damaging 0.94
R6108:Vmn1r71 UTSW 7 10748618 missense probably benign 0.01
R6455:Vmn1r71 UTSW 7 10748404 missense probably benign 0.01
R6582:Vmn1r71 UTSW 7 10748681 missense probably benign 0.00
R6696:Vmn1r71 UTSW 7 10748474 missense probably damaging 0.96
R6778:Vmn1r71 UTSW 7 10748216 missense probably benign 0.02
R7347:Vmn1r71 UTSW 7 10748501 missense not run
R7631:Vmn1r71 UTSW 7 10748451 missense probably damaging 1.00
R7795:Vmn1r71 UTSW 7 10748209 missense probably damaging 0.98
R7820:Vmn1r71 UTSW 7 10748725 missense possibly damaging 0.85
R7836:Vmn1r71 UTSW 7 10748350 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GACAAGGAATGGCTCTCTTAATG -3'
(R):5'- TTGGCAAGTGTCTCCATGATTG -3'

Sequencing Primer
(F):5'- GGCTCTCTTAATGTTCTTTATTGACC -3'
(R):5'- CCATGATTGTCATTCTGTACAGACAC -3'
Posted On2016-06-15