Incidental Mutation 'R5115:Cwc15'
ID394153
Institutional Source Beutler Lab
Gene Symbol Cwc15
Ensembl Gene ENSMUSG00000004096
Gene NameCWC15 spliceosome-associated protein
Synonyms
MMRRC Submission 042703-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5115 (G1)
Quality Score197
Status Validated
Chromosome9
Chromosomal Location14500617-14510577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14507896 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 163 (I163V)
Ref Sequence ENSEMBL: ENSMUSP00000149476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004200] [ENSMUST00000213913] [ENSMUST00000215143]
Predicted Effect probably benign
Transcript: ENSMUST00000004200
AA Change: I163V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000004200
Gene: ENSMUSG00000004096
AA Change: I163V

DomainStartEndE-ValueType
Pfam:Cwf_Cwc_15 1 229 1.5e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213913
AA Change: I163V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216619
Meta Mutation Damage Score 0.0843 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 C T 11: 54,340,498 probably null Het
Asic1 C T 15: 99,672,052 L85F probably damaging Het
Atic G A 1: 71,557,275 probably null Het
Atp1b2 T C 11: 69,603,473 T65A probably damaging Het
C2cd6 T A 1: 59,051,261 I446L probably benign Het
Cep83 A G 10: 94,768,889 H488R probably benign Het
Cyp11b2 A T 15: 74,855,428 probably null Het
Fat2 A G 11: 55,296,333 V1229A probably damaging Het
Fbn1 T C 2: 125,332,383 D1851G probably damaging Het
Golga7 A T 8: 23,245,970 probably null Het
Gsdmc2 A T 15: 63,827,768 H270Q probably benign Het
Kdm4a G T 4: 118,162,581 P326Q possibly damaging Het
Kng1 G A 16: 23,069,282 R209H possibly damaging Het
Mfn1 T C 3: 32,564,307 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Nlrc5 G A 8: 94,476,819 V516I possibly damaging Het
Nrbp1 T G 5: 31,243,715 Y96* probably null Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pikfyve T C 1: 65,224,117 probably benign Het
Plin1 AGGCCACCAGGGGGTGGGC AGGC 7: 79,729,944 probably benign Het
Prkdc A G 16: 15,790,580 Q3082R probably benign Het
Rbfox1 A G 16: 7,409,772 S405G probably damaging Het
Recql T C 6: 142,358,559 probably benign Het
Serpina3c T C 12: 104,147,392 E365G probably damaging Het
Slc17a5 A G 9: 78,577,112 V122A probably benign Het
Sprr2b G T 3: 92,317,555 C36F unknown Het
Stk36 T C 1: 74,635,827 I1307T probably damaging Het
Tmc6 G A 11: 117,775,188 T300I probably damaging Het
Ttll9 C A 2: 152,989,590 probably benign Het
Vmn1r71 T A 7: 10,747,958 M202L probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Cwc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02249:Cwc15 APN 9 14503681 missense probably benign 0.00
IGL02490:Cwc15 APN 9 14502024 missense probably damaging 1.00
R1061:Cwc15 UTSW 9 14507915 missense probably damaging 1.00
R1732:Cwc15 UTSW 9 14510247 missense probably benign 0.00
R5373:Cwc15 UTSW 9 14504938 missense possibly damaging 0.93
R5374:Cwc15 UTSW 9 14504938 missense possibly damaging 0.93
R6273:Cwc15 UTSW 9 14510241 missense probably benign
R6537:Cwc15 UTSW 9 14501988 missense probably damaging 1.00
R7297:Cwc15 UTSW 9 14510229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTATCACTGCAAATGGGG -3'
(R):5'- CTGATTGGGAAGGTTATCAACAG -3'

Sequencing Primer
(F):5'- TCAGAAGGTCAAGGTCATCCTCTG -3'
(R):5'- TTATCAACAGAAAGTGGGATCCTAG -3'
Posted On2016-06-15