Incidental Mutation 'R5115:Cep83'
ID394155
Institutional Source Beutler Lab
Gene Symbol Cep83
Ensembl Gene ENSMUSG00000020024
Gene Namecentrosomal protein 83
Synonyms4921537D05Rik, Ccdc41, 5730513H21Rik, 2600001G24Rik
MMRRC Submission 042703-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5115 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location94688654-94790853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94768889 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 488 (H488R)
Ref Sequence ENSEMBL: ENSMUSP00000020212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020212]
Predicted Effect probably benign
Transcript: ENSMUST00000020212
AA Change: H488R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020212
Gene: ENSMUSG00000020024
AA Change: H488R

DomainStartEndE-ValueType
coiled coil region 31 100 N/A INTRINSIC
coiled coil region 121 602 N/A INTRINSIC
coiled coil region 656 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218076
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a centriolar protein involved in primary cilium assembly. Defects in this gene have been associated with infantile nephronophthisis and intellectual disability. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 C T 11: 54,340,498 probably null Het
Asic1 C T 15: 99,672,052 L85F probably damaging Het
Atic G A 1: 71,557,275 probably null Het
Atp1b2 T C 11: 69,603,473 T65A probably damaging Het
C2cd6 T A 1: 59,051,261 I446L probably benign Het
Cwc15 A G 9: 14,507,896 I163V probably benign Het
Cyp11b2 A T 15: 74,855,428 probably null Het
Fat2 A G 11: 55,296,333 V1229A probably damaging Het
Fbn1 T C 2: 125,332,383 D1851G probably damaging Het
Golga7 A T 8: 23,245,970 probably null Het
Gsdmc2 A T 15: 63,827,768 H270Q probably benign Het
Kdm4a G T 4: 118,162,581 P326Q possibly damaging Het
Kng1 G A 16: 23,069,282 R209H possibly damaging Het
Mfn1 T C 3: 32,564,307 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Nlrc5 G A 8: 94,476,819 V516I possibly damaging Het
Nrbp1 T G 5: 31,243,715 Y96* probably null Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pikfyve T C 1: 65,224,117 probably benign Het
Plin1 AGGCCACCAGGGGGTGGGC AGGC 7: 79,729,944 probably benign Het
Prkdc A G 16: 15,790,580 Q3082R probably benign Het
Rbfox1 A G 16: 7,409,772 S405G probably damaging Het
Recql T C 6: 142,358,559 probably benign Het
Serpina3c T C 12: 104,147,392 E365G probably damaging Het
Slc17a5 A G 9: 78,577,112 V122A probably benign Het
Sprr2b G T 3: 92,317,555 C36F unknown Het
Stk36 T C 1: 74,635,827 I1307T probably damaging Het
Tmc6 G A 11: 117,775,188 T300I probably damaging Het
Ttll9 C A 2: 152,989,590 probably benign Het
Vmn1r71 T A 7: 10,747,958 M202L probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Cep83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Cep83 APN 10 94789764 missense possibly damaging 0.77
IGL00912:Cep83 APN 10 94737866 nonsense probably null
IGL01141:Cep83 APN 10 94788757 missense probably benign 0.39
R0358:Cep83 UTSW 10 94719731 missense probably benign
R0530:Cep83 UTSW 10 94719588 splice site probably benign
R0579:Cep83 UTSW 10 94749053 missense possibly damaging 0.58
R1140:Cep83 UTSW 10 94737890 missense probably damaging 1.00
R1573:Cep83 UTSW 10 94788663 missense probably damaging 1.00
R1756:Cep83 UTSW 10 94750267 missense probably damaging 1.00
R3121:Cep83 UTSW 10 94786838 missense probably damaging 1.00
R3684:Cep83 UTSW 10 94786825 missense probably benign 0.01
R5325:Cep83 UTSW 10 94737906 missense probably damaging 0.98
R5439:Cep83 UTSW 10 94789738 missense probably benign 0.03
R5782:Cep83 UTSW 10 94749032 missense probably damaging 1.00
R5891:Cep83 UTSW 10 94725675 missense probably benign 0.12
R7229:Cep83 UTSW 10 94719665 missense probably damaging 1.00
R7632:Cep83 UTSW 10 94750640 missense probably damaging 1.00
R8043:Cep83 UTSW 10 94737942 missense probably damaging 0.99
R8167:Cep83 UTSW 10 94728717 missense possibly damaging 0.56
R8171:Cep83 UTSW 10 94768935 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCTATTCATTACTCACTTACAGGGC -3'
(R):5'- TAGAAGGAGAAAGTAACTTCCCAC -3'

Sequencing Primer
(F):5'- GCACCCTGCATGCCTCAC -3'
(R):5'- CTTCCCACAAATACATTCAATGTTTC -3'
Posted On2016-06-15