Incidental Mutation 'R5115:Tmc6'
ID394159
Institutional Source Beutler Lab
Gene Symbol Tmc6
Ensembl Gene ENSMUSG00000025572
Gene Nametransmembrane channel-like gene family 6
SynonymsD11Ertd204e, EVER1
MMRRC Submission 042703-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5115 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117765988-117782198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117775188 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 300 (T300I)
Ref Sequence ENSEMBL: ENSMUSP00000026659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000103025] [ENSMUST00000127227] [ENSMUST00000131606] [ENSMUST00000136729] [ENSMUST00000143406] [ENSMUST00000152304]
Predicted Effect probably damaging
Transcript: ENSMUST00000026659
AA Change: T300I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572
AA Change: T300I

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103025
SMART Domains Protein: ENSMUSP00000099314
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127227
Predicted Effect probably benign
Transcript: ENSMUST00000131606
SMART Domains Protein: ENSMUSP00000123264
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136729
SMART Domains Protein: ENSMUSP00000118068
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143406
SMART Domains Protein: ENSMUSP00000117566
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149589
SMART Domains Protein: ENSMUSP00000116521
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
Pfam:TMC 61 108 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152304
Meta Mutation Damage Score 0.1293 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 C T 11: 54,340,498 probably null Het
Asic1 C T 15: 99,672,052 L85F probably damaging Het
Atic G A 1: 71,557,275 probably null Het
Atp1b2 T C 11: 69,603,473 T65A probably damaging Het
C2cd6 T A 1: 59,051,261 I446L probably benign Het
Cep83 A G 10: 94,768,889 H488R probably benign Het
Cwc15 A G 9: 14,507,896 I163V probably benign Het
Cyp11b2 A T 15: 74,855,428 probably null Het
Fat2 A G 11: 55,296,333 V1229A probably damaging Het
Fbn1 T C 2: 125,332,383 D1851G probably damaging Het
Golga7 A T 8: 23,245,970 probably null Het
Gsdmc2 A T 15: 63,827,768 H270Q probably benign Het
Kdm4a G T 4: 118,162,581 P326Q possibly damaging Het
Kng1 G A 16: 23,069,282 R209H possibly damaging Het
Mfn1 T C 3: 32,564,307 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Nlrc5 G A 8: 94,476,819 V516I possibly damaging Het
Nrbp1 T G 5: 31,243,715 Y96* probably null Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pikfyve T C 1: 65,224,117 probably benign Het
Plin1 AGGCCACCAGGGGGTGGGC AGGC 7: 79,729,944 probably benign Het
Prkdc A G 16: 15,790,580 Q3082R probably benign Het
Rbfox1 A G 16: 7,409,772 S405G probably damaging Het
Recql T C 6: 142,358,559 probably benign Het
Serpina3c T C 12: 104,147,392 E365G probably damaging Het
Slc17a5 A G 9: 78,577,112 V122A probably benign Het
Sprr2b G T 3: 92,317,555 C36F unknown Het
Stk36 T C 1: 74,635,827 I1307T probably damaging Het
Ttll9 C A 2: 152,989,590 probably benign Het
Vmn1r71 T A 7: 10,747,958 M202L probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Tmc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Tmc6 APN 11 117779046 missense probably damaging 0.99
IGL02637:Tmc6 APN 11 117767590 missense possibly damaging 0.94
PIT4520001:Tmc6 UTSW 11 117772730 missense possibly damaging 0.55
R0140:Tmc6 UTSW 11 117766251 unclassified probably benign
R0149:Tmc6 UTSW 11 117769448 missense probably damaging 1.00
R0437:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R1566:Tmc6 UTSW 11 117769436 missense probably damaging 0.99
R2011:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2012:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2169:Tmc6 UTSW 11 117769106 missense probably damaging 1.00
R2568:Tmc6 UTSW 11 117772820 missense probably benign 0.08
R3853:Tmc6 UTSW 11 117773058 nonsense probably null
R4049:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R4655:Tmc6 UTSW 11 117773042 missense possibly damaging 0.62
R4708:Tmc6 UTSW 11 117768948 missense probably benign 0.00
R5001:Tmc6 UTSW 11 117770784 missense probably benign 0.28
R5551:Tmc6 UTSW 11 117769445 missense probably damaging 1.00
R5667:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5671:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5763:Tmc6 UTSW 11 117769433 missense possibly damaging 0.90
R6137:Tmc6 UTSW 11 117776328 missense probably damaging 1.00
R6354:Tmc6 UTSW 11 117774236 missense probably benign 0.32
R6418:Tmc6 UTSW 11 117770500 missense probably damaging 0.99
R6868:Tmc6 UTSW 11 117774317 missense probably benign 0.01
R7006:Tmc6 UTSW 11 117774257 missense probably damaging 0.96
R7208:Tmc6 UTSW 11 117776325 missense probably benign 0.41
R7210:Tmc6 UTSW 11 117775844 missense possibly damaging 0.59
R7633:Tmc6 UTSW 11 117769220 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACCTGTATACCAGAATGATGCAGG -3'
(R):5'- CTTCTGGAGGCCCAAGAATG -3'

Sequencing Primer
(F):5'- TGTATACCAGAATGATGCAGGTAAGG -3'
(R):5'- CCATTTGGGGTCTGAATACAGTATCC -3'
Posted On2016-06-15