Incidental Mutation 'R5115:Rbfox1'
ID394165
Institutional Source Beutler Lab
Gene Symbol Rbfox1
Ensembl Gene ENSMUSG00000008658
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 1
SynonymsFOX1, A2bp, A2bp1, HRNBP1
MMRRC Submission 042703-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5115 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5885355-7411526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7409772 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 405 (S405G)
Ref Sequence ENSEMBL: ENSMUSP00000155364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056416] [ENSMUST00000115841] [ENSMUST00000229741] [ENSMUST00000231031] [ENSMUST00000231088] [ENSMUST00000231194]
Predicted Effect probably damaging
Transcript: ENSMUST00000056416
AA Change: S384G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049970
Gene: ENSMUSG00000008658
AA Change: S384G

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
RRM 137 208 1.77e-24 SMART
Pfam:Fox-1_C 272 362 1.7e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115841
AA Change: S384G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111507
Gene: ENSMUSG00000008658
AA Change: S384G

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RRM 117 188 1.77e-24 SMART
Pfam:Fox-1_C 252 341 2.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229741
AA Change: S405G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231031
AA Change: S121G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000231088
AA Change: S346G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000231194
AA Change: S384G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.2007 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit reduced fertility, infrequent spontaneous seizures, increased susceptibility to kainic acid-induced seizures and lethality, and increased neuronal excitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 C T 11: 54,340,498 probably null Het
Asic1 C T 15: 99,672,052 L85F probably damaging Het
Atic G A 1: 71,557,275 probably null Het
Atp1b2 T C 11: 69,603,473 T65A probably damaging Het
C2cd6 T A 1: 59,051,261 I446L probably benign Het
Cep83 A G 10: 94,768,889 H488R probably benign Het
Cwc15 A G 9: 14,507,896 I163V probably benign Het
Cyp11b2 A T 15: 74,855,428 probably null Het
Fat2 A G 11: 55,296,333 V1229A probably damaging Het
Fbn1 T C 2: 125,332,383 D1851G probably damaging Het
Golga7 A T 8: 23,245,970 probably null Het
Gsdmc2 A T 15: 63,827,768 H270Q probably benign Het
Kdm4a G T 4: 118,162,581 P326Q possibly damaging Het
Kng1 G A 16: 23,069,282 R209H possibly damaging Het
Mfn1 T C 3: 32,564,307 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Nlrc5 G A 8: 94,476,819 V516I possibly damaging Het
Nrbp1 T G 5: 31,243,715 Y96* probably null Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pikfyve T C 1: 65,224,117 probably benign Het
Plin1 AGGCCACCAGGGGGTGGGC AGGC 7: 79,729,944 probably benign Het
Prkdc A G 16: 15,790,580 Q3082R probably benign Het
Recql T C 6: 142,358,559 probably benign Het
Serpina3c T C 12: 104,147,392 E365G probably damaging Het
Slc17a5 A G 9: 78,577,112 V122A probably benign Het
Sprr2b G T 3: 92,317,555 C36F unknown Het
Stk36 T C 1: 74,635,827 I1307T probably damaging Het
Tmc6 G A 11: 117,775,188 T300I probably damaging Het
Ttll9 C A 2: 152,989,590 probably benign Het
Vmn1r71 T A 7: 10,747,958 M202L probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Rbfox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Rbfox1 APN 16 7369834 missense probably benign 0.02
IGL01070:Rbfox1 APN 16 7306443 missense possibly damaging 0.78
IGL02633:Rbfox1 APN 16 7292214 missense probably damaging 0.99
IGL03037:Rbfox1 APN 16 7292283 splice site probably benign
R0006:Rbfox1 UTSW 16 7330420 missense probably benign 0.21
R0647:Rbfox1 UTSW 16 7224384 missense probably damaging 1.00
R1439:Rbfox1 UTSW 16 7330433 missense possibly damaging 0.51
R1656:Rbfox1 UTSW 16 7306469 splice site probably benign
R1677:Rbfox1 UTSW 16 7292227 missense possibly damaging 0.92
R2155:Rbfox1 UTSW 16 7294082 missense possibly damaging 0.91
R3236:Rbfox1 UTSW 16 7408028 missense possibly damaging 0.94
R4952:Rbfox1 UTSW 16 7277088 missense probably benign 0.00
R4971:Rbfox1 UTSW 16 7294088 missense probably damaging 1.00
R5784:Rbfox1 UTSW 16 7224339 missense probably damaging 0.96
R6380:Rbfox1 UTSW 16 7224350 nonsense probably null
R7102:Rbfox1 UTSW 16 7369834 missense probably benign 0.02
R7104:Rbfox1 UTSW 16 7353003 missense possibly damaging 0.90
R7218:Rbfox1 UTSW 16 7294083 missense probably damaging 1.00
R7348:Rbfox1 UTSW 16 7408024 nonsense probably null
R7383:Rbfox1 UTSW 16 7070035 missense probably benign 0.17
R7903:Rbfox1 UTSW 16 7224511 missense probably benign 0.20
R8161:Rbfox1 UTSW 16 7277028 missense
Predicted Primers PCR Primer
(F):5'- ACTTTCTGACAAGGTCTGGG -3'
(R):5'- TGATGTCCTACTGCATGTGATG -3'

Sequencing Primer
(F):5'- GGGGTGCCCTCTAATTTGC -3'
(R):5'- TGTGATGCAACACTCAGGC -3'
Posted On2016-06-15