Incidental Mutation 'R5116:Jak1'
ID394184
Institutional Source Beutler Lab
Gene Symbol Jak1
Ensembl Gene ENSMUSG00000028530
Gene NameJanus kinase 1
Synonyms
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101152367-101265282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101155113 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1053 (I1053T)
Ref Sequence ENSEMBL: ENSMUSP00000099842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038463] [ENSMUST00000102781]
Predicted Effect probably benign
Transcript: ENSMUST00000038463
SMART Domains Protein: ENSMUSP00000043142
Gene: ENSMUSG00000035275

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
RRM 59 125 8.2e-11 SMART
RRM 132 205 1.67e-11 SMART
RRM 221 294 2.12e-4 SMART
low complexity region 362 379 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102781
AA Change: I1053T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099842
Gene: ENSMUSG00000028530
AA Change: I1053T

DomainStartEndE-ValueType
B41 32 286 2.45e-58 SMART
Blast:B41 291 420 4e-51 BLAST
SH2 437 531 1.85e-13 SMART
STYKc 582 844 6.72e-14 SMART
TyrKc 874 1148 9.01e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151235
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for disruption of this gene die within the first 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Jak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Jak1 APN 4 101154629 missense probably damaging 1.00
IGL00990:Jak1 APN 4 101171357 missense probably damaging 1.00
IGL01341:Jak1 APN 4 101175093 missense probably damaging 0.98
IGL02102:Jak1 APN 4 101159086 missense probably benign 0.11
IGL02720:Jak1 APN 4 101164450 splice site probably benign
IGL03301:Jak1 APN 4 101175173 missense probably damaging 1.00
Back UTSW 4 101174211 critical splice acceptor site probably null
Behind UTSW 4 101154537 critical splice donor site probably null
BB006:Jak1 UTSW 4 101154645 missense probably damaging 1.00
BB016:Jak1 UTSW 4 101154645 missense probably damaging 1.00
PIT4377001:Jak1 UTSW 4 101179551 missense probably benign 0.19
R0308:Jak1 UTSW 4 101154535 splice site probably null
R0544:Jak1 UTSW 4 101191625 missense probably benign
R1212:Jak1 UTSW 4 101189094 missense probably damaging 1.00
R1519:Jak1 UTSW 4 101162922 missense probably damaging 0.99
R1627:Jak1 UTSW 4 101191624 splice site probably null
R1760:Jak1 UTSW 4 101162929 missense probably benign 0.04
R2116:Jak1 UTSW 4 101179675 missense probably damaging 0.98
R2980:Jak1 UTSW 4 101179781 missense probably damaging 0.99
R3738:Jak1 UTSW 4 101191468 unclassified probably benign
R3779:Jak1 UTSW 4 101156490 missense probably benign 0.40
R4172:Jak1 UTSW 4 101159132 missense probably benign 0.08
R4505:Jak1 UTSW 4 101154603 missense probably benign
R4602:Jak1 UTSW 4 101179594 missense possibly damaging 0.83
R4755:Jak1 UTSW 4 101174157 missense probably damaging 1.00
R4836:Jak1 UTSW 4 101155066 missense probably damaging 0.97
R4908:Jak1 UTSW 4 101179714 missense probably damaging 1.00
R6190:Jak1 UTSW 4 101175128 missense probably damaging 1.00
R6339:Jak1 UTSW 4 101161926 missense probably damaging 0.99
R6500:Jak1 UTSW 4 101181933 missense probably benign 0.43
R6551:Jak1 UTSW 4 101193843 start gained probably benign
R6895:Jak1 UTSW 4 101154537 critical splice donor site probably null
R7163:Jak1 UTSW 4 101175188 missense probably damaging 1.00
R7204:Jak1 UTSW 4 101175135 missense probably benign 0.02
R7361:Jak1 UTSW 4 101184339 missense possibly damaging 0.86
R7408:Jak1 UTSW 4 101175182 missense probably damaging 0.96
R7513:Jak1 UTSW 4 101191651 missense probably damaging 0.96
R7617:Jak1 UTSW 4 101174211 critical splice acceptor site probably null
R7779:Jak1 UTSW 4 101160142 missense probably benign
R7929:Jak1 UTSW 4 101154645 missense probably damaging 1.00
R8282:Jak1 UTSW 4 101179541 nonsense probably null
Z1176:Jak1 UTSW 4 101163681 missense probably damaging 1.00
Z1176:Jak1 UTSW 4 101163722 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACCATGTGAGATAGCATGCTG -3'
(R):5'- GAACACAGATATCTCGTTTAAGGGC -3'

Sequencing Primer
(F):5'- GTGAGATAGCATGCTGTAACCCTC -3'
(R):5'- GGCACGTGACTTACATTCT -3'
Posted On2016-06-15