Incidental Mutation 'R5116:Clip1'
ID394188
Institutional Source Beutler Lab
Gene Symbol Clip1
Ensembl Gene ENSMUSG00000049550
Gene NameCAP-GLY domain containing linker protein 1
SynonymsClip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123577795-123684618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123630707 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 610 (A610T)
Ref Sequence ENSEMBL: ENSMUSP00000107192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]
Predicted Effect probably benign
Transcript: ENSMUST00000031382
AA Change: A656T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: A656T

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.28e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.28e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 451 N/A INTRINSIC
coiled coil region 474 535 N/A INTRINSIC
coiled coil region 581 620 N/A INTRINSIC
coiled coil region 652 1352 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
Pfam:CLIP1_ZNF 1375 1392 5.8e-9 PFAM
ZnF_C2HC 1417 1433 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063905
AA Change: A645T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: A645T

DomainStartEndE-ValueType
internal_repeat_2 11 53 3.3e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 3.3e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1075 N/A INTRINSIC
coiled coil region 1115 1235 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
ZnF_C2HC 1300 1316 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111561
AA Change: A645T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: A645T

DomainStartEndE-ValueType
internal_repeat_2 11 53 1.93e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 1.93e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1341 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
ZnF_C2HC 1406 1422 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111564
AA Change: A610T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: A610T

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.5e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.5e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1230 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
ZnF_C2HC 1295 1311 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111566
AA Change: A610T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: A610T

DomainStartEndE-ValueType
internal_repeat_2 11 53 2e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1306 N/A INTRINSIC
low complexity region 1316 1327 N/A INTRINSIC
ZnF_C2HC 1371 1387 1.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122603
Predicted Effect unknown
Transcript: ENSMUST00000137363
AA Change: A397T
SMART Domains Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: A397T

DomainStartEndE-ValueType
CAP_GLY 2 31 2.59e0 SMART
low complexity region 39 57 N/A INTRINSIC
low complexity region 58 84 N/A INTRINSIC
coiled coil region 101 276 N/A INTRINSIC
coiled coil region 322 361 N/A INTRINSIC
coiled coil region 393 980 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Pfam:CLIP1_ZNF 1004 1021 4.2e-9 PFAM
ZnF_C2HC 1046 1062 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144121
SMART Domains Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
CAP_GLY 37 102 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149410
AA Change: A579T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550
AA Change: A579T

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
CAP_GLY 60 125 1.05e-31 SMART
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 334 458 N/A INTRINSIC
coiled coil region 504 543 N/A INTRINSIC
coiled coil region 575 827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199018
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Clip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Clip1 APN 5 123603654 missense possibly damaging 0.94
IGL01067:Clip1 APN 5 123630804 missense probably damaging 0.99
IGL01524:Clip1 APN 5 123579379 missense probably damaging 1.00
IGL01632:Clip1 APN 5 123617496 missense probably damaging 1.00
IGL01798:Clip1 APN 5 123583549 missense probably damaging 1.00
IGL01874:Clip1 APN 5 123603666 missense possibly damaging 0.50
IGL01908:Clip1 APN 5 123623207 splice site probably benign
IGL02120:Clip1 APN 5 123647883 missense probably damaging 1.00
IGL02309:Clip1 APN 5 123617700 missense probably damaging 0.99
IGL02555:Clip1 APN 5 123621794 critical splice donor site probably null
IGL03027:Clip1 APN 5 123621856 missense probably benign 0.43
IGL03336:Clip1 APN 5 123653570 nonsense probably null
IGL03365:Clip1 APN 5 123583586 missense probably damaging 1.00
IGL02802:Clip1 UTSW 5 123631123 missense probably damaging 1.00
PIT4812001:Clip1 UTSW 5 123630675 missense probably benign 0.08
R0254:Clip1 UTSW 5 123617332 splice site probably benign
R0401:Clip1 UTSW 5 123653789 missense probably damaging 1.00
R0530:Clip1 UTSW 5 123640531 missense probably damaging 1.00
R0744:Clip1 UTSW 5 123630721 missense probably benign 0.05
R0833:Clip1 UTSW 5 123630721 missense probably benign 0.05
R1116:Clip1 UTSW 5 123579491 missense probably damaging 0.99
R1182:Clip1 UTSW 5 123647865 missense probably damaging 1.00
R1656:Clip1 UTSW 5 123630403 missense possibly damaging 0.61
R1700:Clip1 UTSW 5 123630370 missense probably benign
R1889:Clip1 UTSW 5 123653496 missense probably damaging 0.99
R1975:Clip1 UTSW 5 123623218 missense possibly damaging 0.79
R2406:Clip1 UTSW 5 123603660 missense probably damaging 1.00
R3545:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3547:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3548:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3911:Clip1 UTSW 5 123590834 missense probably damaging 1.00
R3944:Clip1 UTSW 5 123617829 unclassified probably benign
R4660:Clip1 UTSW 5 123579374 missense probably damaging 0.98
R4784:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4785:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4824:Clip1 UTSW 5 123631023 missense probably damaging 1.00
R4831:Clip1 UTSW 5 123583601 missense probably damaging 1.00
R4951:Clip1 UTSW 5 123630345 missense probably benign 0.02
R4960:Clip1 UTSW 5 123654003 nonsense probably null
R5014:Clip1 UTSW 5 123617730 missense probably damaging 0.99
R5212:Clip1 UTSW 5 123630681 missense probably benign 0.09
R5238:Clip1 UTSW 5 123647883 missense probably damaging 1.00
R5318:Clip1 UTSW 5 123613084 unclassified probably benign
R5372:Clip1 UTSW 5 123630240 missense probably benign 0.02
R5701:Clip1 UTSW 5 123613303 unclassified probably benign
R5734:Clip1 UTSW 5 123615154 unclassified probably benign
R5757:Clip1 UTSW 5 123627397 missense probably benign 0.21
R6024:Clip1 UTSW 5 123615089 missense possibly damaging 0.66
R6160:Clip1 UTSW 5 123613541 missense possibly damaging 0.66
R6177:Clip1 UTSW 5 123613834 unclassified probably benign
R6183:Clip1 UTSW 5 123642604 missense probably damaging 1.00
R6377:Clip1 UTSW 5 123603654 missense possibly damaging 0.50
R6436:Clip1 UTSW 5 123641785 missense probably damaging 1.00
R6471:Clip1 UTSW 5 123640549 missense probably damaging 0.99
R6766:Clip1 UTSW 5 123614764 unclassified probably benign
R7015:Clip1 UTSW 5 123613612 unclassified probably benign
R7094:Clip1 UTSW 5 123623270 missense probably benign 0.02
R7143:Clip1 UTSW 5 123653610 missense probably benign
R7222:Clip1 UTSW 5 123611841 missense probably damaging 0.99
R7233:Clip1 UTSW 5 123611859 missense probably damaging 1.00
R7238:Clip1 UTSW 5 123613265 missense
R7249:Clip1 UTSW 5 123603600 missense probably damaging 1.00
R7283:Clip1 UTSW 5 123613794 missense
R7295:Clip1 UTSW 5 123627356 missense probably benign 0.19
R7447:Clip1 UTSW 5 123653633 missense probably benign 0.03
R7458:Clip1 UTSW 5 123640546 missense probably damaging 1.00
R7483:Clip1 UTSW 5 123617384 missense probably benign 0.00
R7516:Clip1 UTSW 5 123583385 missense probably benign 0.00
R7619:Clip1 UTSW 5 123614279 missense
R7831:Clip1 UTSW 5 123613279 missense
R7897:Clip1 UTSW 5 123622798 missense probably benign
R8155:Clip1 UTSW 5 123613636 missense
R8157:Clip1 UTSW 5 123630719 missense probably benign 0.17
R8232:Clip1 UTSW 5 123647918 missense probably benign 0.05
R8396:Clip1 UTSW 5 123642564 missense probably damaging 1.00
R8446:Clip1 UTSW 5 123655945 missense probably damaging 1.00
R8511:Clip1 UTSW 5 123653906 missense possibly damaging 0.50
Z1177:Clip1 UTSW 5 123617350 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCAGTCTCGCTTTGACG -3'
(R):5'- TCAGAAGGAGATCAAGGCTCTG -3'

Sequencing Primer
(F):5'- TCGCTTTGACGGCCTCCAG -3'
(R):5'- ACGGCCACTGAGAAGCTTTC -3'
Posted On2016-06-15