Mutagenetix > Incidental Mutation

Incidental Mutation 'R5116:Ccr8'

394202

Institutional Source

Beutler Lab

Gene Symbol

Ccr8

Ensembl Gene

ENSMUSG00000042262

Gene Name

chemokine (C-C motif) receptor 8

Synonyms

Cmkbr8

MMRRC Submission

042704-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5116 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120092114-120094906 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120094029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 70 (I70T)

Ref Sequence

ENSEMBL: ENSMUSP00000038473 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048777]

AlphaFold

P56484

Predicted Effect

probably benign
Transcript: ENSMUST00000048777
AA Change: I70T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000038473
Gene: ENSMUSG00000042262
AA Change: I70T

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	44	313	2.4e-8	PFAM
Pfam:7tm_1	50	298	3.3e-44	PFAM
low complexity region	338	347	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217495

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.5%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two independently generated knock-out alleles show normal lung eosinophilia and Th2 cytokine responses in OVA-elicited asthma models. Mice homozygous for a third knock-out allele show a delay in onset of clinical signs of experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	T	C	5: 124,078,867	H429R	probably damaging	Het
Adam39	G	T	8: 40,825,001	C143F	probably damaging	Het
Adamts19	T	C	18: 58,902,994	V417A	possibly damaging	Het
Adcy10	C	A	1: 165,519,500	A362E	probably damaging	Het
Akap6	A	G	12: 53,141,515	E1904G	probably benign	Het
Aldh18a1	A	G	19: 40,553,505	M89T	probably benign	Het
Alyref	G	T	11: 120,597,728	F91L	probably benign	Het
Capn3	G	T	2: 120,485,292	M248I	probably benign	Het
Catsper4	A	T	4: 134,226,680	I56N	probably damaging	Het
Ccdc151	A	G	9: 21,990,128	*595Q	probably null	Het
Cckbr	T	A	7: 105,433,655	I75N	probably damaging	Het
Cdh24	T	C	14: 54,636,413	D428G	probably benign	Het
Cdk5rap2	G	T	4: 70,307,238	Q557K	possibly damaging	Het
Clip1	C	T	5: 123,630,707	A610T	probably benign	Het
Dnajc16	A	T	4: 141,767,969	Y479*	probably null	Het
Fpr-rs3	A	G	17: 20,624,300	V193A	probably benign	Het
Gm29125	T	C	1: 80,383,973		noncoding transcript	Het
Hist1h1e	A	G	13: 23,622,287	Y71H	probably damaging	Het
Ifi208	A	G	1: 173,677,983		probably benign	Het
Immp1l	G	A	2: 105,965,295	R155H	probably benign	Het
Itgad	C	A	7: 128,203,893	T7K	probably damaging	Het
Itgb3	T	C	11: 104,641,077	V370A	probably benign	Het
Jak1	A	G	4: 101,155,113	I1053T	probably benign	Het
Kif21b	A	G	1: 136,152,783	R572G	probably damaging	Het
Lama2	A	T	10: 27,118,560	D1784E	probably benign	Het
Ltbp2	A	T	12: 84,809,737	V651D	probably damaging	Het
Mrpl47	A	G	3: 32,733,601	L100S	probably damaging	Het
Mx1	T	G	16: 97,457,479	N6T	possibly damaging	Het
Nde1	T	A	16: 14,183,487	M133K	probably benign	Het
Nlrc5	T	C	8: 94,481,860	L778P	probably damaging	Het
Olfr1156	G	A	2: 87,949,529	R235C	probably benign	Het
Olfr603	G	A	7: 103,383,864	T46I	probably benign	Het
Olfr803	A	G	10: 129,691,397	S215P	probably damaging	Het
Olfr850	A	G	9: 19,477,798	S151P	possibly damaging	Het
Olfr885	T	C	9: 38,061,338	V6A	probably benign	Het
Otog	T	C	7: 46,273,767	V1022A	probably benign	Het
Pcdhac1	G	A	18: 37,091,447	V438M	probably damaging	Het
Pcsk5	G	A	19: 17,463,434	S1264F	possibly damaging	Het
Pfas	T	C	11: 68,990,990		probably benign	Het
Pigr	T	A	1: 130,849,031	F648I	probably benign	Het
Pla2r1	A	C	2: 60,448,906	Y777D	probably damaging	Het
Pnpla7	G	T	2: 25,021,970	G716V	probably damaging	Het
Rab11fip5	C	T	6: 85,348,807	E206K	probably damaging	Het
S100a10	A	G	3: 93,560,940		probably null	Het
Slc35f1	T	C	10: 53,021,895	I134T	probably benign	Het
Smarcd1	C	T	15: 99,702,488	A56V	probably benign	Het
Snrk	A	G	9: 122,160,330	T247A	probably benign	Het
Srgap1	A	G	10: 121,792,379	L896P	possibly damaging	Het
Tmem19	A	T	10: 115,343,746	F167I	probably benign	Het
Tmprss11f	T	C	5: 86,539,696	S118G	probably benign	Het
Tnc	A	G	4: 63,967,215		probably null	Het
Trem3	T	C	17: 48,249,552	L17P	probably benign	Het
Upp2	A	G	2: 58,771,542	Y67C	probably damaging	Het
Zfp276	A	G	8: 123,264,977		probably benign	Het
Zfp932	T	A	5: 110,009,376	D280E	probably benign	Het

Other mutations in Ccr8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01511:Ccr8	APN	9	120094625	missense	probably damaging	1.00
IGL02558:Ccr8	APN	9	120094658	missense	probably benign	0.01
IGL02966:Ccr8	APN	9	120094140	missense	probably damaging	0.96
IGL03135:Ccr8	APN	9	120094623	missense	possibly damaging	0.89
R0402:Ccr8	UTSW	9	120094910	splice site	probably null
R0739:Ccr8	UTSW	9	120094349	missense	probably damaging	1.00
R1069:Ccr8	UTSW	9	120094217	missense	probably benign	0.00
R4766:Ccr8	UTSW	9	120094464	missense	probably damaging	1.00
R4934:Ccr8	UTSW	9	120094749	missense	probably benign
R5942:Ccr8	UTSW	9	120094706	missense	probably damaging	0.99
R5957:Ccr8	UTSW	9	120093827	missense	probably damaging	0.99
R5996:Ccr8	UTSW	9	120094463	missense	probably damaging	1.00
R7223:Ccr8	UTSW	9	120094617	missense	probably damaging	0.99
R8037:Ccr8	UTSW	9	120094370	missense	probably benign
R8332:Ccr8	UTSW	9	120094374	missense	probably damaging	1.00
R8962:Ccr8	UTSW	9	120094547	missense	possibly damaging	0.56
R9344:Ccr8	UTSW	9	120094067	missense	probably damaging	1.00
Z1177:Ccr8	UTSW	9	120094499	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- ACGTCACGATGACCGACTAC -3'
(R):5'- CCTTGATGGCATAGACAGCGTG -3'

Sequencing Primer
(F):5'- GATGACCGACTACTACCCTGATTTC -3'
(R):5'- GATACCTGTCCACACTCATTAGGG -3'

Posted On

2016-06-15